Incidental Mutation 'R5470:Slc35e2'
ID433453
Institutional Source Beutler Lab
Gene Symbol Slc35e2
Ensembl Gene ENSMUSG00000042202
Gene Namesolute carrier family 35, member E2
Synonyms
MMRRC Submission 043031-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5470 (G1)
Quality Score176
Status Validated
Chromosome4
Chromosomal Location155601416-155623340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 155610026 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 10 (P10L)
Ref Sequence ENSEMBL: ENSMUSP00000113189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043829] [ENSMUST00000105608] [ENSMUST00000115821] [ENSMUST00000118607]
Predicted Effect probably benign
Transcript: ENSMUST00000043829
AA Change: P10L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041449
Gene: ENSMUSG00000042202
AA Change: P10L

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
Pfam:TPT 73 368 7.9e-93 PFAM
Pfam:UAA 74 371 1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105608
AA Change: P10L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101233
Gene: ENSMUSG00000042202
AA Change: P10L

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
Pfam:UAA 75 375 6.9e-10 PFAM
Pfam:EamA 84 215 5.8e-8 PFAM
Pfam:TPT 224 369 3.8e-34 PFAM
Pfam:EamA 237 369 3.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115821
SMART Domains Protein: ENSMUSP00000111488
Gene: ENSMUSG00000073682

DomainStartEndE-ValueType
SCOP:d1l9ha_ 17 52 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118607
AA Change: P10L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113189
Gene: ENSMUSG00000042202
AA Change: P10L

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
Pfam:UAA 75 375 6.9e-10 PFAM
Pfam:EamA 84 215 5.8e-8 PFAM
Pfam:TPT 224 369 3.8e-34 PFAM
Pfam:EamA 237 369 3.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151425
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency 99% (79/80)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,168,941 I813F probably damaging Het
Aqr G A 2: 114,157,575 L169F probably damaging Het
Atp6v1d G A 12: 78,845,284 R182C probably benign Het
Bcl2l13 G T 6: 120,862,872 A44S probably benign Het
Brip1 T C 11: 86,148,542 K389E possibly damaging Het
C530025M09Rik G A 2: 149,831,125 probably benign Het
Ccdc7b T A 8: 129,072,600 S53T possibly damaging Het
Chd8 A G 14: 52,212,609 F154L probably damaging Het
Cop1 A T 1: 159,266,860 probably benign Het
Cyp2c39 A G 19: 39,513,530 K121R possibly damaging Het
Cyp3a57 A G 5: 145,372,619 M256V probably benign Het
Deup1 T C 9: 15,582,620 probably null Het
Dnah10 A G 5: 124,753,168 N709D probably benign Het
Dthd1 A G 5: 62,818,766 Y261C probably damaging Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
En2 C T 5: 28,166,924 T133M probably benign Het
Endou A G 15: 97,718,955 F229S probably damaging Het
Etl4 A T 2: 20,529,980 H79L probably damaging Het
Fah C T 7: 84,593,185 probably null Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fignl1 T A 11: 11,802,640 E138D probably benign Het
Fndc3a A G 14: 72,574,568 L311P possibly damaging Het
Gdf9 T A 11: 53,436,754 V179E probably benign Het
Gm14129 G T 2: 148,927,817 noncoding transcript Het
Gorab A G 1: 163,392,509 I188T probably damaging Het
Gpr152 G A 19: 4,143,129 C223Y probably damaging Het
Heatr5b A T 17: 78,821,579 probably null Het
Hsd17b3 G T 13: 64,073,899 T104N probably damaging Het
Il6ra C T 3: 89,885,995 V283M probably benign Het
Klk1b16 A T 7: 44,137,331 I5F probably damaging Het
Krt74 G A 15: 101,754,465 noncoding transcript Het
Lrch3 T A 16: 32,998,590 N650K probably damaging Het
Ly96 A T 1: 16,709,486 E126D probably benign Het
Mgarp C A 3: 51,391,285 R66L possibly damaging Het
Naalad2 T A 9: 18,330,851 T586S probably damaging Het
Ndufaf3 T C 9: 108,566,444 probably benign Het
Neb A G 2: 52,249,438 M3055T possibly damaging Het
Neo1 G T 9: 58,931,067 A478D probably damaging Het
Nmrk1 A T 19: 18,639,884 probably null Het
Nsl1 T C 1: 191,080,540 M184T probably benign Het
Nup133 T C 8: 123,930,966 N410S probably benign Het
Olfr23 T C 11: 73,940,870 I208T probably benign Het
Olfr399 A G 11: 74,053,907 I284T possibly damaging Het
Olfr610 T G 7: 103,506,509 I146L probably benign Het
Opalin A G 19: 41,066,531 S75P probably benign Het
Palb2 C A 7: 122,114,351 C903F probably damaging Het
Pcm1 T A 8: 41,287,683 W989R probably damaging Het
Pfkfb4 T A 9: 109,027,593 I389N probably damaging Het
Pitrm1 T C 13: 6,553,270 C119R probably benign Het
Plekha1 T C 7: 130,908,376 V45A probably damaging Het
Pold2 G A 11: 5,873,048 P376S probably damaging Het
Rcan2 A G 17: 43,836,283 D4G probably benign Het
Slc12a1 A T 2: 125,170,714 T299S probably damaging Het
Slc22a29 A T 19: 8,161,516 H527Q probably benign Het
Slc22a8 G A 19: 8,607,870 R261H probably damaging Het
Slco4a1 T C 2: 180,474,114 F681S probably benign Het
Sorcs2 A T 5: 36,031,183 H860Q probably benign Het
Strn A T 17: 78,656,945 H530Q probably benign Het
Tex14 A G 11: 87,551,604 R179G probably damaging Het
Tjp3 T C 10: 81,279,547 D350G probably benign Het
Tnrc6b G T 15: 80,916,711 R1406L possibly damaging Het
Tnxb A G 17: 34,716,973 D2666G probably null Het
Ttn A T 2: 76,729,864 Y27652N probably benign Het
Utp20 T A 10: 88,817,896 E287D probably benign Het
Vmn1r45 T C 6: 89,933,716 I91V probably benign Het
Wdr72 A T 9: 74,139,699 K76* probably null Het
Zfp689 C T 7: 127,444,253 A402T probably damaging Het
Zfpm1 A G 8: 122,333,793 E207G probably damaging Het
Zhx2 G T 15: 57,823,074 R613L possibly damaging Het
Other mutations in Slc35e2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01919:Slc35e2 APN 4 155612730 missense probably benign
IGL02244:Slc35e2 APN 4 155618562 missense probably damaging 0.97
R1774:Slc35e2 UTSW 4 155610164 missense possibly damaging 0.51
R1856:Slc35e2 UTSW 4 155611729 missense probably damaging 1.00
R4600:Slc35e2 UTSW 4 155617649 missense probably benign 0.04
R4601:Slc35e2 UTSW 4 155617649 missense probably benign 0.04
R4603:Slc35e2 UTSW 4 155617649 missense probably benign 0.04
R4610:Slc35e2 UTSW 4 155617649 missense probably benign 0.04
R4917:Slc35e2 UTSW 4 155616236 missense probably damaging 1.00
R4918:Slc35e2 UTSW 4 155616236 missense probably damaging 1.00
R5440:Slc35e2 UTSW 4 155610026 missense probably benign
R5468:Slc35e2 UTSW 4 155610026 missense probably benign
R5469:Slc35e2 UTSW 4 155610026 missense probably benign
R5512:Slc35e2 UTSW 4 155610026 missense probably benign
R5513:Slc35e2 UTSW 4 155610026 missense probably benign
R5514:Slc35e2 UTSW 4 155610026 missense probably benign
R5689:Slc35e2 UTSW 4 155610026 missense probably benign
R5692:Slc35e2 UTSW 4 155610026 missense probably benign
R5711:Slc35e2 UTSW 4 155610026 missense probably benign
R5714:Slc35e2 UTSW 4 155610026 missense probably benign
R5799:Slc35e2 UTSW 4 155610026 missense probably benign
R5872:Slc35e2 UTSW 4 155612680 missense probably damaging 1.00
R5925:Slc35e2 UTSW 4 155611627 missense probably damaging 1.00
R5947:Slc35e2 UTSW 4 155611714 missense possibly damaging 0.70
R6044:Slc35e2 UTSW 4 155610026 missense probably benign
R6063:Slc35e2 UTSW 4 155610026 missense probably benign
R6065:Slc35e2 UTSW 4 155610026 missense probably benign
R6066:Slc35e2 UTSW 4 155610026 missense probably benign
R6188:Slc35e2 UTSW 4 155610026 missense probably benign
R6243:Slc35e2 UTSW 4 155610026 missense probably benign
R6273:Slc35e2 UTSW 4 155610026 missense probably benign
R6484:Slc35e2 UTSW 4 155612647 missense probably damaging 0.99
R6867:Slc35e2 UTSW 4 155618700 missense probably benign 0.00
R7143:Slc35e2 UTSW 4 155618594 missense probably benign 0.01
R7384:Slc35e2 UTSW 4 155610632 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCTCCACATATGTCTGCAC -3'
(R):5'- CGACTCAATGACAGTGGTCTC -3'

Sequencing Primer
(F):5'- CAGGTGTCAAATGCATCTTACACAGG -3'
(R):5'- ACTCAATGACAGTGGTCTCTGTGATG -3'
Posted On2016-10-06