Incidental Mutation 'R5470:Klk1b16'
ID433461
Institutional Source Beutler Lab
Gene Symbol Klk1b16
Ensembl Gene ENSMUSG00000038968
Gene Namekallikrein 1-related peptidase b16
SynonymsKlk16, mGk-16
MMRRC Submission 043031-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5470 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44136767-44141610 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44137331 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 5 (I5F)
Ref Sequence ENSEMBL: ENSMUSP00000005933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005933]
Predicted Effect probably damaging
Transcript: ENSMUST00000005933
AA Change: I5F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000005933
Gene: ENSMUSG00000038968
AA Change: I5F

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 7.64e-80 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206376
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,168,941 I813F probably damaging Het
Aqr G A 2: 114,157,575 L169F probably damaging Het
Atp6v1d G A 12: 78,845,284 R182C probably benign Het
Bcl2l13 G T 6: 120,862,872 A44S probably benign Het
Brip1 T C 11: 86,148,542 K389E possibly damaging Het
C530025M09Rik G A 2: 149,831,125 probably benign Het
Ccdc7b T A 8: 129,072,600 S53T possibly damaging Het
Chd8 A G 14: 52,212,609 F154L probably damaging Het
Cop1 A T 1: 159,266,860 probably benign Het
Cyp2c39 A G 19: 39,513,530 K121R possibly damaging Het
Cyp3a57 A G 5: 145,372,619 M256V probably benign Het
Deup1 T C 9: 15,582,620 probably null Het
Dnah10 A G 5: 124,753,168 N709D probably benign Het
Dthd1 A G 5: 62,818,766 Y261C probably damaging Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
En2 C T 5: 28,166,924 T133M probably benign Het
Endou A G 15: 97,718,955 F229S probably damaging Het
Etl4 A T 2: 20,529,980 H79L probably damaging Het
Fah C T 7: 84,593,185 probably null Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fignl1 T A 11: 11,802,640 E138D probably benign Het
Fndc3a A G 14: 72,574,568 L311P possibly damaging Het
Gdf9 T A 11: 53,436,754 V179E probably benign Het
Gm14129 G T 2: 148,927,817 noncoding transcript Het
Gorab A G 1: 163,392,509 I188T probably damaging Het
Gpr152 G A 19: 4,143,129 C223Y probably damaging Het
Heatr5b A T 17: 78,821,579 probably null Het
Hsd17b3 G T 13: 64,073,899 T104N probably damaging Het
Il6ra C T 3: 89,885,995 V283M probably benign Het
Krt74 G A 15: 101,754,465 noncoding transcript Het
Lrch3 T A 16: 32,998,590 N650K probably damaging Het
Ly96 A T 1: 16,709,486 E126D probably benign Het
Mgarp C A 3: 51,391,285 R66L possibly damaging Het
Naalad2 T A 9: 18,330,851 T586S probably damaging Het
Ndufaf3 T C 9: 108,566,444 probably benign Het
Neb A G 2: 52,249,438 M3055T possibly damaging Het
Neo1 G T 9: 58,931,067 A478D probably damaging Het
Nmrk1 A T 19: 18,639,884 probably null Het
Nsl1 T C 1: 191,080,540 M184T probably benign Het
Nup133 T C 8: 123,930,966 N410S probably benign Het
Olfr23 T C 11: 73,940,870 I208T probably benign Het
Olfr399 A G 11: 74,053,907 I284T possibly damaging Het
Olfr610 T G 7: 103,506,509 I146L probably benign Het
Opalin A G 19: 41,066,531 S75P probably benign Het
Palb2 C A 7: 122,114,351 C903F probably damaging Het
Pcm1 T A 8: 41,287,683 W989R probably damaging Het
Pfkfb4 T A 9: 109,027,593 I389N probably damaging Het
Pitrm1 T C 13: 6,553,270 C119R probably benign Het
Plekha1 T C 7: 130,908,376 V45A probably damaging Het
Pold2 G A 11: 5,873,048 P376S probably damaging Het
Rcan2 A G 17: 43,836,283 D4G probably benign Het
Slc12a1 A T 2: 125,170,714 T299S probably damaging Het
Slc22a29 A T 19: 8,161,516 H527Q probably benign Het
Slc22a8 G A 19: 8,607,870 R261H probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slco4a1 T C 2: 180,474,114 F681S probably benign Het
Sorcs2 A T 5: 36,031,183 H860Q probably benign Het
Strn A T 17: 78,656,945 H530Q probably benign Het
Tex14 A G 11: 87,551,604 R179G probably damaging Het
Tjp3 T C 10: 81,279,547 D350G probably benign Het
Tnrc6b G T 15: 80,916,711 R1406L possibly damaging Het
Tnxb A G 17: 34,716,973 D2666G probably null Het
Ttn A T 2: 76,729,864 Y27652N probably benign Het
Utp20 T A 10: 88,817,896 E287D probably benign Het
Vmn1r45 T C 6: 89,933,716 I91V probably benign Het
Wdr72 A T 9: 74,139,699 K76* probably null Het
Zfp689 C T 7: 127,444,253 A402T probably damaging Het
Zfpm1 A G 8: 122,333,793 E207G probably damaging Het
Zhx2 G T 15: 57,823,074 R613L possibly damaging Het
Other mutations in Klk1b16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Klk1b16 APN 7 44140678 missense probably damaging 0.98
IGL01529:Klk1b16 APN 7 44140739 missense probably benign 0.18
R1105:Klk1b16 UTSW 7 44139513 missense probably damaging 0.98
R1106:Klk1b16 UTSW 7 44139513 missense probably damaging 0.98
R1559:Klk1b16 UTSW 7 44141001 missense probably benign 0.00
R3883:Klk1b16 UTSW 7 44139463 missense possibly damaging 0.86
R3884:Klk1b16 UTSW 7 44139463 missense possibly damaging 0.86
R4152:Klk1b16 UTSW 7 44140549 missense probably benign 0.09
R4398:Klk1b16 UTSW 7 44141427 missense probably damaging 1.00
R5231:Klk1b16 UTSW 7 44137347 missense probably damaging 1.00
R5389:Klk1b16 UTSW 7 44140988 missense possibly damaging 0.83
R5532:Klk1b16 UTSW 7 44141526 missense probably benign 0.00
R5690:Klk1b16 UTSW 7 44140894 critical splice acceptor site probably null
R5717:Klk1b16 UTSW 7 44139489 missense probably benign 0.00
R5749:Klk1b16 UTSW 7 44140786 missense probably benign 0.03
R6589:Klk1b16 UTSW 7 44141470 missense probably benign 0.03
R7084:Klk1b16 UTSW 7 44139486 missense probably benign 0.01
R7336:Klk1b16 UTSW 7 44141483 missense probably benign 0.05
R8281:Klk1b16 UTSW 7 44141547 missense probably benign
R8358:Klk1b16 UTSW 7 44140761 missense probably damaging 1.00
X0026:Klk1b16 UTSW 7 44140944 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACAGTGGGTACAACGAGGC -3'
(R):5'- TTCTGTGAGCAAGGACTGTGAG -3'

Sequencing Primer
(F):5'- ATTCCACAGCCAGGATGGTG -3'
(R):5'- ACTGTGAGGGACCTGGCAG -3'
Posted On2016-10-06