Incidental Mutation 'R5470:Plekha1'
ID433466
Institutional Source Beutler Lab
Gene Symbol Plekha1
Ensembl Gene ENSMUSG00000040268
Gene Namepleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1
SynonymsTAPP1, C920009D07Rik
MMRRC Submission 043031-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R5470 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location130865756-130913312 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130908376 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 45 (V45A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048180] [ENSMUST00000075181] [ENSMUST00000120441] [ENSMUST00000124096] [ENSMUST00000151119]
Predicted Effect probably benign
Transcript: ENSMUST00000048180
AA Change: V236A

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000035375
Gene: ENSMUSG00000040268
AA Change: V236A

DomainStartEndE-ValueType
PDB:1V5P|A 1 75 2e-33 PDB
Blast:PH 8 78 1e-36 BLAST
PH 144 243 1.71e-21 SMART
low complexity region 244 261 N/A INTRINSIC
low complexity region 268 287 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075181
AA Change: V284A

PolyPhen 2 Score 0.327 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000074675
Gene: ENSMUSG00000040268
AA Change: V284A

DomainStartEndE-ValueType
PH 8 114 2.16e-9 SMART
PH 192 291 1.71e-21 SMART
low complexity region 330 341 N/A INTRINSIC
low complexity region 370 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120441
AA Change: V284A

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112777
Gene: ENSMUSG00000040268
AA Change: V284A

DomainStartEndE-ValueType
PH 8 114 2.16e-9 SMART
PH 192 291 1.71e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126355
AA Change: V45A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114411
Gene: ENSMUSG00000040268
AA Change: V45A

DomainStartEndE-ValueType
Pfam:PH 2 51 6e-8 PFAM
low complexity region 102 113 N/A INTRINSIC
low complexity region 142 153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135359
Predicted Effect probably benign
Transcript: ENSMUST00000136963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149029
Predicted Effect unknown
Transcript: ENSMUST00000151119
AA Change: V284A
SMART Domains Protein: ENSMUSP00000123600
Gene: ENSMUSG00000040268
AA Change: V284A

DomainStartEndE-ValueType
PDB:1V5P|A 1 67 3e-35 PDB
Blast:PH 8 67 7e-38 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198082
Meta Mutation Damage Score 0.5707 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pleckstrin homology domain-containing adapter protein. The encoded protein is localized to the plasma membrane where it specifically binds phosphatidylinositol 3,4-bisphosphate. This protein may be involved in the formation of signaling complexes in the plasma membrane. Polymorphisms in this gene are associated with age-related macular degeneration. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 5.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mcie homozygous for a gene trapped allele exhibit postnatal lethality and increased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,168,941 I813F probably damaging Het
Aqr G A 2: 114,157,575 L169F probably damaging Het
Atp6v1d G A 12: 78,845,284 R182C probably benign Het
Bcl2l13 G T 6: 120,862,872 A44S probably benign Het
Brip1 T C 11: 86,148,542 K389E possibly damaging Het
C530025M09Rik G A 2: 149,831,125 probably benign Het
Ccdc7b T A 8: 129,072,600 S53T possibly damaging Het
Chd8 A G 14: 52,212,609 F154L probably damaging Het
Cop1 A T 1: 159,266,860 probably benign Het
Cyp2c39 A G 19: 39,513,530 K121R possibly damaging Het
Cyp3a57 A G 5: 145,372,619 M256V probably benign Het
Deup1 T C 9: 15,582,620 probably null Het
Dnah10 A G 5: 124,753,168 N709D probably benign Het
Dthd1 A G 5: 62,818,766 Y261C probably damaging Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
En2 C T 5: 28,166,924 T133M probably benign Het
Endou A G 15: 97,718,955 F229S probably damaging Het
Etl4 A T 2: 20,529,980 H79L probably damaging Het
Fah C T 7: 84,593,185 probably null Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fignl1 T A 11: 11,802,640 E138D probably benign Het
Fndc3a A G 14: 72,574,568 L311P possibly damaging Het
Gdf9 T A 11: 53,436,754 V179E probably benign Het
Gm14129 G T 2: 148,927,817 noncoding transcript Het
Gorab A G 1: 163,392,509 I188T probably damaging Het
Gpr152 G A 19: 4,143,129 C223Y probably damaging Het
Heatr5b A T 17: 78,821,579 probably null Het
Hsd17b3 G T 13: 64,073,899 T104N probably damaging Het
Il6ra C T 3: 89,885,995 V283M probably benign Het
Klk1b16 A T 7: 44,137,331 I5F probably damaging Het
Krt74 G A 15: 101,754,465 noncoding transcript Het
Lrch3 T A 16: 32,998,590 N650K probably damaging Het
Ly96 A T 1: 16,709,486 E126D probably benign Het
Mgarp C A 3: 51,391,285 R66L possibly damaging Het
Naalad2 T A 9: 18,330,851 T586S probably damaging Het
Ndufaf3 T C 9: 108,566,444 probably benign Het
Neb A G 2: 52,249,438 M3055T possibly damaging Het
Neo1 G T 9: 58,931,067 A478D probably damaging Het
Nmrk1 A T 19: 18,639,884 probably null Het
Nsl1 T C 1: 191,080,540 M184T probably benign Het
Nup133 T C 8: 123,930,966 N410S probably benign Het
Olfr23 T C 11: 73,940,870 I208T probably benign Het
Olfr399 A G 11: 74,053,907 I284T possibly damaging Het
Olfr610 T G 7: 103,506,509 I146L probably benign Het
Opalin A G 19: 41,066,531 S75P probably benign Het
Palb2 C A 7: 122,114,351 C903F probably damaging Het
Pcm1 T A 8: 41,287,683 W989R probably damaging Het
Pfkfb4 T A 9: 109,027,593 I389N probably damaging Het
Pitrm1 T C 13: 6,553,270 C119R probably benign Het
Pold2 G A 11: 5,873,048 P376S probably damaging Het
Rcan2 A G 17: 43,836,283 D4G probably benign Het
Slc12a1 A T 2: 125,170,714 T299S probably damaging Het
Slc22a29 A T 19: 8,161,516 H527Q probably benign Het
Slc22a8 G A 19: 8,607,870 R261H probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slco4a1 T C 2: 180,474,114 F681S probably benign Het
Sorcs2 A T 5: 36,031,183 H860Q probably benign Het
Strn A T 17: 78,656,945 H530Q probably benign Het
Tex14 A G 11: 87,551,604 R179G probably damaging Het
Tjp3 T C 10: 81,279,547 D350G probably benign Het
Tnrc6b G T 15: 80,916,711 R1406L possibly damaging Het
Tnxb A G 17: 34,716,973 D2666G probably null Het
Ttn A T 2: 76,729,864 Y27652N probably benign Het
Utp20 T A 10: 88,817,896 E287D probably benign Het
Vmn1r45 T C 6: 89,933,716 I91V probably benign Het
Wdr72 A T 9: 74,139,699 K76* probably null Het
Zfp689 C T 7: 127,444,253 A402T probably damaging Het
Zfpm1 A G 8: 122,333,793 E207G probably damaging Het
Zhx2 G T 15: 57,823,074 R613L possibly damaging Het
Other mutations in Plekha1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Plekha1 APN 7 130877839 missense probably damaging 1.00
IGL00973:Plekha1 APN 7 130911013 missense probably damaging 0.96
IGL01010:Plekha1 APN 7 130902254 splice site probably benign
IGL01726:Plekha1 APN 7 130897329 missense probably damaging 1.00
R0137:Plekha1 UTSW 7 130897446 missense probably damaging 0.98
R0681:Plekha1 UTSW 7 130900623 missense possibly damaging 0.50
R1304:Plekha1 UTSW 7 130902219 missense probably benign
R1786:Plekha1 UTSW 7 130892253 missense probably benign 0.02
R2036:Plekha1 UTSW 7 130902192 missense probably damaging 1.00
R2844:Plekha1 UTSW 7 130908365 missense probably damaging 1.00
R2845:Plekha1 UTSW 7 130908365 missense probably damaging 1.00
R2846:Plekha1 UTSW 7 130908365 missense probably damaging 1.00
R5119:Plekha1 UTSW 7 130905364 intron probably benign
R5167:Plekha1 UTSW 7 130885449 critical splice donor site probably null
R5536:Plekha1 UTSW 7 130909601 missense probably damaging 0.96
R5975:Plekha1 UTSW 7 130892253 missense probably benign 0.02
R6087:Plekha1 UTSW 7 130900571 missense probably benign 0.06
R6346:Plekha1 UTSW 7 130877782 missense probably benign 0.17
R7581:Plekha1 UTSW 7 130910865 missense probably benign
R8152:Plekha1 UTSW 7 130908372 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTCCCAATAATACATGCTCACC -3'
(R):5'- GCAAGTCCAATTGGTATGAAAGTCAAC -3'

Sequencing Primer
(F):5'- TTTAATCTCAGCACTCAGGAGGCAG -3'
(R):5'- TTTCTCCCCAAGAAGGAG -3'
Posted On2016-10-06