Incidental Mutation 'R5470:Olfr23'
ID433481
Institutional Source Beutler Lab
Gene Symbol Olfr23
Ensembl Gene ENSMUSG00000069816
Gene Nameolfactory receptor 23
SynonymsMTPCR50, MOR135-27, GA_x6K02T2P1NL-4097159-4098136
MMRRC Submission 043031-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R5470 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73936677-73942658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73940870 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 208 (I208T)
Ref Sequence ENSEMBL: ENSMUSP00000150593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092917] [ENSMUST00000121280] [ENSMUST00000214210]
Predicted Effect probably benign
Transcript: ENSMUST00000092917
AA Change: I208T

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000090596
Gene: ENSMUSG00000069816
AA Change: I208T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.8e-60 PFAM
Pfam:7TM_GPCR_Srsx 35 305 3.8e-6 PFAM
Pfam:7tm_1 41 290 9.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121280
AA Change: I208T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000113870
Gene: ENSMUSG00000057050
AA Change: I208T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 305 1.3e-6 PFAM
Pfam:7tm_1 41 290 4.3e-35 PFAM
Pfam:7tm_4 139 283 1.2e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214210
AA Change: I208T

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,168,941 I813F probably damaging Het
Aqr G A 2: 114,157,575 L169F probably damaging Het
Atp6v1d G A 12: 78,845,284 R182C probably benign Het
Bcl2l13 G T 6: 120,862,872 A44S probably benign Het
Brip1 T C 11: 86,148,542 K389E possibly damaging Het
C530025M09Rik G A 2: 149,831,125 probably benign Het
Ccdc7b T A 8: 129,072,600 S53T possibly damaging Het
Chd8 A G 14: 52,212,609 F154L probably damaging Het
Cop1 A T 1: 159,266,860 probably benign Het
Cyp2c39 A G 19: 39,513,530 K121R possibly damaging Het
Cyp3a57 A G 5: 145,372,619 M256V probably benign Het
Deup1 T C 9: 15,582,620 probably null Het
Dnah10 A G 5: 124,753,168 N709D probably benign Het
Dthd1 A G 5: 62,818,766 Y261C probably damaging Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
En2 C T 5: 28,166,924 T133M probably benign Het
Endou A G 15: 97,718,955 F229S probably damaging Het
Etl4 A T 2: 20,529,980 H79L probably damaging Het
Fah C T 7: 84,593,185 probably null Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fignl1 T A 11: 11,802,640 E138D probably benign Het
Fndc3a A G 14: 72,574,568 L311P possibly damaging Het
Gdf9 T A 11: 53,436,754 V179E probably benign Het
Gm14129 G T 2: 148,927,817 noncoding transcript Het
Gorab A G 1: 163,392,509 I188T probably damaging Het
Gpr152 G A 19: 4,143,129 C223Y probably damaging Het
Heatr5b A T 17: 78,821,579 probably null Het
Hsd17b3 G T 13: 64,073,899 T104N probably damaging Het
Il6ra C T 3: 89,885,995 V283M probably benign Het
Klk1b16 A T 7: 44,137,331 I5F probably damaging Het
Krt74 G A 15: 101,754,465 noncoding transcript Het
Lrch3 T A 16: 32,998,590 N650K probably damaging Het
Ly96 A T 1: 16,709,486 E126D probably benign Het
Mgarp C A 3: 51,391,285 R66L possibly damaging Het
Naalad2 T A 9: 18,330,851 T586S probably damaging Het
Ndufaf3 T C 9: 108,566,444 probably benign Het
Neb A G 2: 52,249,438 M3055T possibly damaging Het
Neo1 G T 9: 58,931,067 A478D probably damaging Het
Nmrk1 A T 19: 18,639,884 probably null Het
Nsl1 T C 1: 191,080,540 M184T probably benign Het
Nup133 T C 8: 123,930,966 N410S probably benign Het
Olfr399 A G 11: 74,053,907 I284T possibly damaging Het
Olfr610 T G 7: 103,506,509 I146L probably benign Het
Opalin A G 19: 41,066,531 S75P probably benign Het
Palb2 C A 7: 122,114,351 C903F probably damaging Het
Pcm1 T A 8: 41,287,683 W989R probably damaging Het
Pfkfb4 T A 9: 109,027,593 I389N probably damaging Het
Pitrm1 T C 13: 6,553,270 C119R probably benign Het
Plekha1 T C 7: 130,908,376 V45A probably damaging Het
Pold2 G A 11: 5,873,048 P376S probably damaging Het
Rcan2 A G 17: 43,836,283 D4G probably benign Het
Slc12a1 A T 2: 125,170,714 T299S probably damaging Het
Slc22a29 A T 19: 8,161,516 H527Q probably benign Het
Slc22a8 G A 19: 8,607,870 R261H probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slco4a1 T C 2: 180,474,114 F681S probably benign Het
Sorcs2 A T 5: 36,031,183 H860Q probably benign Het
Strn A T 17: 78,656,945 H530Q probably benign Het
Tex14 A G 11: 87,551,604 R179G probably damaging Het
Tjp3 T C 10: 81,279,547 D350G probably benign Het
Tnrc6b G T 15: 80,916,711 R1406L possibly damaging Het
Tnxb A G 17: 34,716,973 D2666G probably null Het
Ttn A T 2: 76,729,864 Y27652N probably benign Het
Utp20 T A 10: 88,817,896 E287D probably benign Het
Vmn1r45 T C 6: 89,933,716 I91V probably benign Het
Wdr72 A T 9: 74,139,699 K76* probably null Het
Zfp689 C T 7: 127,444,253 A402T probably damaging Het
Zfpm1 A G 8: 122,333,793 E207G probably damaging Het
Zhx2 G T 15: 57,823,074 R613L possibly damaging Het
Other mutations in Olfr23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Olfr23 APN 11 73941194 missense probably benign
IGL02290:Olfr23 APN 11 73940869 missense probably benign 0.00
IGL02301:Olfr23 APN 11 73941068 missense possibly damaging 0.79
IGL02303:Olfr23 APN 11 73940450 missense possibly damaging 0.87
IGL02510:Olfr23 APN 11 73941005 missense probably damaging 1.00
IGL02558:Olfr23 APN 11 73940825 missense probably benign 0.01
IGL02712:Olfr23 APN 11 73940930 missense probably benign 0.12
IGL02795:Olfr23 APN 11 73940929 missense probably benign 0.05
IGL02800:Olfr23 APN 11 73941116 missense probably damaging 1.00
IGL03350:Olfr23 APN 11 73940838 missense probably damaging 0.99
R0277:Olfr23 UTSW 11 73940947 missense probably benign 0.28
R0323:Olfr23 UTSW 11 73940947 missense probably benign 0.28
R0333:Olfr23 UTSW 11 73940767 missense possibly damaging 0.78
R0389:Olfr23 UTSW 11 73941053 missense probably benign 0.12
R0391:Olfr23 UTSW 11 73941109 missense probably damaging 1.00
R0723:Olfr23 UTSW 11 73940270 missense probably benign 0.00
R1469:Olfr23 UTSW 11 73940557 missense probably benign 0.05
R1469:Olfr23 UTSW 11 73940557 missense probably benign 0.05
R1900:Olfr23 UTSW 11 73940660 missense possibly damaging 0.79
R2363:Olfr23 UTSW 11 73940356 missense possibly damaging 0.96
R4236:Olfr23 UTSW 11 73940356 missense possibly damaging 0.96
R4630:Olfr23 UTSW 11 73940996 missense probably damaging 1.00
R4717:Olfr23 UTSW 11 73940815 missense possibly damaging 0.86
R4801:Olfr23 UTSW 11 73940870 missense possibly damaging 0.88
R4802:Olfr23 UTSW 11 73940870 missense possibly damaging 0.88
R4964:Olfr23 UTSW 11 73941202 missense probably benign 0.04
R5119:Olfr23 UTSW 11 73940552 missense possibly damaging 0.76
R6196:Olfr23 UTSW 11 73940809 missense possibly damaging 0.86
R6551:Olfr23 UTSW 11 73940303 missense probably benign 0.11
R7695:Olfr23 UTSW 11 73940894 missense possibly damaging 0.94
R8074:Olfr23 UTSW 11 73940387 missense possibly damaging 0.78
X0065:Olfr23 UTSW 11 73940324 missense possibly damaging 0.59
Z1088:Olfr23 UTSW 11 73941138 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTGACAACATTGTGTGCCATG -3'
(R):5'- GGGAGTCACCACAGTGTACATC -3'

Sequencing Primer
(F):5'- TGCCATGTTGCACACTTTG -3'
(R):5'- GACATGACAGTATCCTTCACAGTAG -3'
Posted On2016-10-06