Incidental Mutation 'R0481:Tlr4'
Institutional Source Beutler Lab
Gene Symbol Tlr4
Ensembl Gene ENSMUSG00000039005
Gene Nametoll-like receptor 4
SynonymsRasl2-8, Lps, lipopolysaccharide response
MMRRC Submission 038681-MU
Accession Numbers

MGI: 96824

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0481 (G1)
Quality Score225
Status Validated
Chromosomal Location66827584-66930284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66827916 bp
Amino Acid Change Isoleucine to Valine at position 29 (I29V)
Ref Sequence ENSEMBL: ENSMUSP00000102988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048096] [ENSMUST00000107365]
Predicted Effect probably benign
Transcript: ENSMUST00000048096
AA Change: I29V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045770
Gene: ENSMUSG00000039005
AA Change: I29V

LRR 76 99 7.36e0 SMART
LRR 100 123 1.86e0 SMART
LRR 173 196 8.24e0 SMART
LRR 370 401 4.33e1 SMART
LRR 468 492 2.54e2 SMART
LRR 493 516 1.86e2 SMART
LRR 517 540 1.67e2 SMART
LRR 541 563 1.92e2 SMART
LRRCT 576 626 4.74e-3 SMART
transmembrane domain 636 658 N/A INTRINSIC
TIR 671 816 7.3e-39 SMART
low complexity region 822 833 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107365
AA Change: I29V

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000102988
Gene: ENSMUSG00000039005
AA Change: I29V

PDB:3VQ2|B 22 86 2e-38 PDB
SCOP:d1m0za_ 27 86 4e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147008
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 95% (89/94)
MGI Phenotype FUNCTION: This gene belongs to the evolutionarily-conserved Toll-like receptor family, whose members are type-1 transmembrane proteins that are involved in innate immunity. Toll-like receptors are characterized by an extracellular leucine-rich repeat domain that functions in ligand recognition and an intracellular toll/interleukin-1 receptor-like domain that is crucial for signal transduction. The receptor encoded by this gene mediates the innate immune response to bacterial lipopolysaccharide, a major component of the outer membrane of Gram-negative bacteria, through synthesis of pro-inflammatory cytokines and chemokines. In addition, this protein can recognize other pathogens from Gram-negative and Gram-positive bacteria as well as viral components. Mice deficient in this gene display a number of immune response-related phenotypes including hyporesponsiveness to bacterial lipopolysaccharide and increased levels of respiratory syncytial virus compared to controls. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous or targeted mutations are hyporesponsive to bacterial lipopolysaccharide and more susceptible to infection by gram negative bacteria. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(2) Spontaneous(6) Chemically induced(2)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932429P05Rik T C X: 89,752,693 S44P probably damaging Het
9530053A07Rik A T 7: 28,153,749 D1487V probably damaging Het
Abcg4 T A 9: 44,279,369 N39Y probably benign Het
Adamts10 C T 17: 33,549,373 Q840* probably null Het
Aff2 C T X: 69,834,642 T678I probably damaging Het
Ahctf1 A G 1: 179,760,271 V1418A probably benign Het
Ankrd11 G A 8: 122,900,036 R136C probably damaging Het
Arf5 A G 6: 28,426,076 Y154C probably damaging Het
AW551984 A G 9: 39,600,616 V33A probably null Het
B4galt5 A G 2: 167,309,234 L118P probably damaging Het
Bcl9l A G 9: 44,506,682 I606V probably benign Het
Bdp1 A G 13: 100,041,454 I1969T probably benign Het
Bicd1 A T 6: 149,511,891 D260V possibly damaging Het
Cap1 A T 4: 122,863,075 H272Q possibly damaging Het
Ccnk A G 12: 108,199,309 probably benign Het
Cd209f A T 8: 4,105,558 probably null Het
Cdk13 C A 13: 17,719,494 A1123S probably damaging Het
Cdx1 C T 18: 61,020,492 R158H probably damaging Het
Chd8 A G 14: 52,237,206 S123P probably benign Het
Cwc22 G A 2: 77,908,111 A497V probably damaging Het
Cwh43 T C 5: 73,418,027 S296P probably damaging Het
Dhx38 A T 8: 109,556,216 probably benign Het
Dnah5 T A 15: 28,383,599 M2989K probably benign Het
Dpy19l4 A C 4: 11,272,993 probably benign Het
F11r A T 1: 171,461,279 H155L probably benign Het
Fitm2 A G 2: 163,469,714 V193A probably benign Het
Foxk1 T A 5: 142,448,823 S281T probably benign Het
Furin A G 7: 80,393,549 C305R probably damaging Het
Fut8 T A 12: 77,448,560 V308D probably damaging Het
Gjb3 T A 4: 127,326,332 I136F probably benign Het
Glmn A T 5: 107,560,934 S385T probably benign Het
Glp1r T A 17: 30,931,217 M371K probably benign Het
Gm906 T A 13: 50,246,964 Q442L probably benign Het
Gpr179 T C 11: 97,349,718 H293R probably damaging Het
H2-M11 A T 17: 36,548,954 R280* probably null Het
Hadhb T A 5: 30,168,545 H78Q probably damaging Het
Hectd4 A G 5: 121,295,506 probably benign Het
Hexa A G 9: 59,555,410 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Hyal6 G A 6: 24,743,418 C371Y probably damaging Het
Il1rap T C 16: 26,692,835 Y210H probably damaging Het
Ino80 A T 2: 119,431,016 H722Q probably damaging Het
Kcnt1 A G 2: 25,892,496 N200S probably damaging Het
Kif27 T A 13: 58,311,264 probably benign Het
Lyst T C 13: 13,677,952 V2179A probably benign Het
Macf1 C A 4: 123,484,022 probably null Het
Mamdc4 A G 2: 25,571,216 M1T probably null Het
Mansc4 A G 6: 147,075,227 I297T possibly damaging Het
Mdn1 G A 4: 32,767,182 probably benign Het
Mib2 A G 4: 155,656,062 probably benign Het
Mon2 A G 10: 123,013,396 V1333A possibly damaging Het
Ndst2 T C 14: 20,724,468 D840G possibly damaging Het
Nell2 A T 15: 95,432,682 probably null Het
Olfr1189 A T 2: 88,592,655 I284F probably damaging Het
Olfr1301 T A 2: 111,754,585 M112K probably damaging Het
Olfr998 C A 2: 85,591,104 A188E possibly damaging Het
Pde5a C T 3: 122,818,077 probably benign Het
Phip A G 9: 82,876,716 probably benign Het
Polr2b A G 5: 77,332,082 I561V possibly damaging Het
Prkg2 A T 5: 98,994,655 probably null Het
Prl8a6 T C 13: 27,433,101 D201G probably benign Het
Ptk6 G A 2: 181,202,527 probably benign Het
Ptprn2 T C 12: 117,211,846 probably benign Het
Rdh1 G T 10: 127,763,124 R158L probably damaging Het
Rhbdl3 T C 11: 80,323,349 probably benign Het
Rims4 A T 2: 163,864,120 V198E probably damaging Het
Ripk1 T C 13: 34,009,750 S32P probably damaging Het
Rnf13 T A 3: 57,779,451 N88K probably damaging Het
Rnf13 C A 3: 57,807,053 L178I probably damaging Het
Slc17a5 G T 9: 78,538,302 probably null Het
Sorcs1 A G 19: 50,636,453 probably benign Het
Srpk1 G A 17: 28,590,244 probably benign Het
Stk10 A G 11: 32,614,708 K840E probably damaging Het
Suco A G 1: 161,862,313 probably benign Het
T2 G A 17: 8,417,175 probably null Het
Tbc1d5 A G 17: 50,919,051 S255P probably damaging Het
Tenm1 T C X: 42,536,181 Y2254C probably damaging Het
Tex9 T A 9: 72,478,396 K11* probably null Het
Tmem255a A T X: 38,199,646 V278D probably damaging Het
Trpc3 T C 3: 36,624,417 I840V probably benign Het
Trpm3 G A 19: 22,901,071 R622Q possibly damaging Het
Vmn1r214 T A 13: 23,035,294 Y319* probably null Het
Vmn1r53 A T 6: 90,223,718 V208E probably damaging Het
Vmn2r89 T C 14: 51,456,120 F309S probably damaging Het
Xirp2 T A 2: 67,509,909 F831L possibly damaging Het
Yes1 G T 5: 32,640,405 E23* probably null Het
Zfp292 A T 4: 34,810,059 M995K probably benign Het
Other mutations in Tlr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Tlr4 APN 4 66840425 missense probably benign 0.01
IGL01343:Tlr4 APN 4 66833887 splice site probably benign
IGL01669:Tlr4 APN 4 66841267 missense possibly damaging 0.48
IGL01875:Tlr4 APN 4 66839489 missense probably damaging 1.00
IGL02138:Tlr4 APN 4 66840965 missense probably damaging 0.99
IGL02244:Tlr4 APN 4 66834061 critical splice donor site probably null
IGL02793:Tlr4 APN 4 66839444 missense probably damaging 1.00
IGL03269:Tlr4 APN 4 66840796 missense probably damaging 1.00
IGL03288:Tlr4 APN 4 66839753 missense probably damaging 0.99
bugsy UTSW 4 66839254 nonsense probably null
Cruyff UTSW 4 66840326 missense probably damaging 1.00
don_knotts UTSW 4 66841172 missense probably damaging 1.00
Guardiola UTSW 4 66839303 missense probably damaging 1.00
Lops UTSW 4 66833880 splice site probably null
lps3 UTSW 4 66841097 missense probably damaging 1.00
Lps4 UTSW 4 66841142 missense probably damaging 1.00
milquetoast UTSW 4 66839444 missense probably damaging 1.00
salvador UTSW 4 66840206 missense probably damaging 0.99
R0449:Tlr4 UTSW 4 66839620 missense probably damaging 0.99
R0576:Tlr4 UTSW 4 66839495 missense probably benign 0.00
R0827:Tlr4 UTSW 4 66833880 splice site probably null
R1488:Tlr4 UTSW 4 66839549 missense probably damaging 1.00
R1490:Tlr4 UTSW 4 66839374 missense possibly damaging 0.56
R1522:Tlr4 UTSW 4 66839696 missense possibly damaging 0.80
R1616:Tlr4 UTSW 4 66839480 missense probably damaging 1.00
R1681:Tlr4 UTSW 4 66841105 missense probably damaging 1.00
R1738:Tlr4 UTSW 4 66841076 missense probably benign 0.19
R1888:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R1888:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R1929:Tlr4 UTSW 4 66839444 missense probably damaging 1.00
R1982:Tlr4 UTSW 4 66841035 missense probably benign 0.40
R1998:Tlr4 UTSW 4 66840470 missense probably damaging 1.00
R2186:Tlr4 UTSW 4 66839983 missense possibly damaging 0.63
R2305:Tlr4 UTSW 4 66840101 missense probably damaging 1.00
R3011:Tlr4 UTSW 4 66839254 nonsense probably null
R3420:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3422:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3818:Tlr4 UTSW 4 66841316 missense probably benign 0.00
R4212:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4213:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4417:Tlr4 UTSW 4 66839303 missense probably damaging 1.00
R4630:Tlr4 UTSW 4 66839240 missense probably benign 0.44
R4735:Tlr4 UTSW 4 66841198 missense probably damaging 1.00
R5191:Tlr4 UTSW 4 66841379 missense probably damaging 0.96
R5613:Tlr4 UTSW 4 66840885 missense possibly damaging 0.94
R5705:Tlr4 UTSW 4 66833980 missense probably damaging 1.00
R5726:Tlr4 UTSW 4 66840415 missense probably benign
R6021:Tlr4 UTSW 4 66840866 missense probably damaging 1.00
R6159:Tlr4 UTSW 4 66839833 missense possibly damaging 0.92
R6227:Tlr4 UTSW 4 66840595 missense probably benign
R7139:Tlr4 UTSW 4 66840283 missense probably benign 0.06
R7199:Tlr4 UTSW 4 66841193 missense probably damaging 0.99
R7220:Tlr4 UTSW 4 66839951 missense probably benign
R7337:Tlr4 UTSW 4 66839954 missense possibly damaging 0.86
R7487:Tlr4 UTSW 4 66924422 missense probably benign 0.00
R7638:Tlr4 UTSW 4 66840206 missense probably damaging 0.99
R7773:Tlr4 UTSW 4 66839599 missense probably damaging 1.00
R7814:Tlr4 UTSW 4 66841079 missense probably damaging 1.00
R7897:Tlr4 UTSW 4 66839821 missense probably benign 0.07
R8044:Tlr4 UTSW 4 66827847 missense probably benign 0.01
R8062:Tlr4 UTSW 4 66839850 missense probably benign 0.00
R8080:Tlr4 UTSW 4 66839476 missense probably damaging 1.00
R8446:Tlr4 UTSW 4 66839436 missense probably damaging 0.98
X0064:Tlr4 UTSW 4 66840140 missense probably damaging 0.99
Z1088:Tlr4 UTSW 4 66929082 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ttcagtaagttctttaacgactctc -3'
Posted On2013-05-23