Mutagenetix > Incidental Mutation

Incidental Mutation 'R0481:Tlr4'

43349

Institutional Source

Beutler Lab

Gene Symbol

Tlr4

Ensembl Gene

ENSMUSG00000039005

Gene Name

toll-like receptor 4

Synonyms

Rasl2-8, Lps, lipopolysaccharide response

MMRRC Submission

038681-MU

Accession Numbers

MGI: 96824

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0481 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

66827584-66930284 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 66827916 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 29 (I29V)

Ref Sequence

ENSEMBL: ENSMUSP00000102988 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048096] [ENSMUST00000107365]

AlphaFold

Q9QUK6

Predicted Effect

probably benign
Transcript: ENSMUST00000048096
AA Change: I29V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000045770
Gene: ENSMUSG00000039005
AA Change: I29V

Domain	Start	End	E-Value	Type
LRR	76	99	7.36e0	SMART
LRR	100	123	1.86e0	SMART
LRR	173	196	8.24e0	SMART
LRR	370	401	4.33e1	SMART
LRR	468	492	2.54e2	SMART
LRR	493	516	1.86e2	SMART
LRR	517	540	1.67e2	SMART
LRR	541	563	1.92e2	SMART
LRRCT	576	626	4.74e-3	SMART
transmembrane domain	636	658	N/A	INTRINSIC
TIR	671	816	7.3e-39	SMART
low complexity region	822	833	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107365
AA Change: I29V

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000102988
Gene: ENSMUSG00000039005
AA Change: I29V

Domain	Start	End	E-Value	Type
PDB:3VQ2\|B	22	86	2e-38	PDB
SCOP:d1m0za_	27	86	4e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143580

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147008

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.5%
20x: 93.3%

Validation Efficiency

95% (89/94)

MGI Phenotype

FUNCTION: This gene belongs to the evolutionarily-conserved Toll-like receptor family, whose members are type-1 transmembrane proteins that are involved in innate immunity. Toll-like receptors are characterized by an extracellular leucine-rich repeat domain that functions in ligand recognition and an intracellular toll/interleukin-1 receptor-like domain that is crucial for signal transduction. The receptor encoded by this gene mediates the innate immune response to bacterial lipopolysaccharide, a major component of the outer membrane of Gram-negative bacteria, through synthesis of pro-inflammatory cytokines and chemokines. In addition, this protein can recognize other pathogens from Gram-negative and Gram-positive bacteria as well as viral components. Mice deficient in this gene display a number of immune response-related phenotypes including hyporesponsiveness to bacterial lipopolysaccharide and increased levels of respiratory syncytial virus compared to controls. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous or targeted mutations are hyporesponsive to bacterial lipopolysaccharide and more susceptible to infection by gram negative bacteria. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Targeted(2) Spontaneous(6) Chemically induced(2)

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932429P05Rik	T	C	X: 89,752,693	S44P	probably damaging	Het
9530053A07Rik	A	T	7: 28,153,749	D1487V	probably damaging	Het
Abcg4	T	A	9: 44,279,369	N39Y	probably benign	Het
Adamts10	C	T	17: 33,549,373	Q840*	probably null	Het
Aff2	C	T	X: 69,834,642	T678I	probably damaging	Het
Ahctf1	A	G	1: 179,760,271	V1418A	probably benign	Het
Ankrd11	G	A	8: 122,900,036	R136C	probably damaging	Het
Arf5	A	G	6: 28,426,076	Y154C	probably damaging	Het
AW551984	A	G	9: 39,600,616	V33A	probably null	Het
B4galt5	A	G	2: 167,309,234	L118P	probably damaging	Het
Bcl9l	A	G	9: 44,506,682	I606V	probably benign	Het
Bdp1	A	G	13: 100,041,454	I1969T	probably benign	Het
Bicd1	A	T	6: 149,511,891	D260V	possibly damaging	Het
Cap1	A	T	4: 122,863,075	H272Q	possibly damaging	Het
Ccnk	A	G	12: 108,199,309		probably benign	Het
Cd209f	A	T	8: 4,105,558		probably null	Het
Cdk13	C	A	13: 17,719,494	A1123S	probably damaging	Het
Cdx1	C	T	18: 61,020,492	R158H	probably damaging	Het
Chd8	A	G	14: 52,237,206	S123P	probably benign	Het
Cwc22	G	A	2: 77,908,111	A497V	probably damaging	Het
Cwh43	T	C	5: 73,418,027	S296P	probably damaging	Het
Dhx38	A	T	8: 109,556,216		probably benign	Het
Dnah5	T	A	15: 28,383,599	M2989K	probably benign	Het
Dpy19l4	A	C	4: 11,272,993		probably benign	Het
F11r	A	T	1: 171,461,279	H155L	probably benign	Het
Fitm2	A	G	2: 163,469,714	V193A	probably benign	Het
Foxk1	T	A	5: 142,448,823	S281T	probably benign	Het
Furin	A	G	7: 80,393,549	C305R	probably damaging	Het
Fut8	T	A	12: 77,448,560	V308D	probably damaging	Het
Gjb3	T	A	4: 127,326,332	I136F	probably benign	Het
Glmn	A	T	5: 107,560,934	S385T	probably benign	Het
Glp1r	T	A	17: 30,931,217	M371K	probably benign	Het
Gm906	T	A	13: 50,246,964	Q442L	probably benign	Het
Gpr179	T	C	11: 97,349,718	H293R	probably damaging	Het
H2-M11	A	T	17: 36,548,954	R280*	probably null	Het
Hadhb	T	A	5: 30,168,545	H78Q	probably damaging	Het
Hectd4	A	G	5: 121,295,506		probably benign	Het
Hexa	A	G	9: 59,555,410		probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Hyal6	G	A	6: 24,743,418	C371Y	probably damaging	Het
Il1rap	T	C	16: 26,692,835	Y210H	probably damaging	Het
Ino80	A	T	2: 119,431,016	H722Q	probably damaging	Het
Kcnt1	A	G	2: 25,892,496	N200S	probably damaging	Het
Kif27	T	A	13: 58,311,264		probably benign	Het
Lyst	T	C	13: 13,677,952	V2179A	probably benign	Het
Macf1	C	A	4: 123,484,022		probably null	Het
Mamdc4	A	G	2: 25,571,216	M1T	probably null	Het
Mansc4	A	G	6: 147,075,227	I297T	possibly damaging	Het
Mdn1	G	A	4: 32,767,182		probably benign	Het
Mib2	A	G	4: 155,656,062		probably benign	Het
Mon2	A	G	10: 123,013,396	V1333A	possibly damaging	Het
Ndst2	T	C	14: 20,724,468	D840G	possibly damaging	Het
Nell2	A	T	15: 95,432,682		probably null	Het
Olfr1189	A	T	2: 88,592,655	I284F	probably damaging	Het
Olfr1301	T	A	2: 111,754,585	M112K	probably damaging	Het
Olfr998	C	A	2: 85,591,104	A188E	possibly damaging	Het
Pde5a	C	T	3: 122,818,077		probably benign	Het
Phip	A	G	9: 82,876,716		probably benign	Het
Polr2b	A	G	5: 77,332,082	I561V	possibly damaging	Het
Prkg2	A	T	5: 98,994,655		probably null	Het
Prl8a6	T	C	13: 27,433,101	D201G	probably benign	Het
Ptk6	G	A	2: 181,202,527		probably benign	Het
Ptprn2	T	C	12: 117,211,846		probably benign	Het
Rdh1	G	T	10: 127,763,124	R158L	probably damaging	Het
Rhbdl3	T	C	11: 80,323,349		probably benign	Het
Rims4	A	T	2: 163,864,120	V198E	probably damaging	Het
Ripk1	T	C	13: 34,009,750	S32P	probably damaging	Het
Rnf13	T	A	3: 57,779,451	N88K	probably damaging	Het
Rnf13	C	A	3: 57,807,053	L178I	probably damaging	Het
Slc17a5	G	T	9: 78,538,302		probably null	Het
Sorcs1	A	G	19: 50,636,453		probably benign	Het
Srpk1	G	A	17: 28,590,244		probably benign	Het
Stk10	A	G	11: 32,614,708	K840E	probably damaging	Het
Suco	A	G	1: 161,862,313		probably benign	Het
T2	G	A	17: 8,417,175		probably null	Het
Tbc1d5	A	G	17: 50,919,051	S255P	probably damaging	Het
Tenm1	T	C	X: 42,536,181	Y2254C	probably damaging	Het
Tex9	T	A	9: 72,478,396	K11*	probably null	Het
Tmem255a	A	T	X: 38,199,646	V278D	probably damaging	Het
Trpc3	T	C	3: 36,624,417	I840V	probably benign	Het
Trpm3	G	A	19: 22,901,071	R622Q	possibly damaging	Het
Vmn1r214	T	A	13: 23,035,294	Y319*	probably null	Het
Vmn1r53	A	T	6: 90,223,718	V208E	probably damaging	Het
Vmn2r89	T	C	14: 51,456,120	F309S	probably damaging	Het
Xirp2	T	A	2: 67,509,909	F831L	possibly damaging	Het
Yes1	G	T	5: 32,640,405	E23*	probably null	Het
Zfp292	A	T	4: 34,810,059	M995K	probably benign	Het

Other mutations in Tlr4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01120:Tlr4	APN	4	66840425	missense	probably benign	0.01
IGL01343:Tlr4	APN	4	66833887	splice site	probably benign
IGL01669:Tlr4	APN	4	66841267	missense	possibly damaging	0.48
IGL01875:Tlr4	APN	4	66839489	missense	probably damaging	1.00
IGL02138:Tlr4	APN	4	66840965	missense	probably damaging	0.99
IGL02244:Tlr4	APN	4	66834061	critical splice donor site	probably null
IGL02793:Tlr4	APN	4	66839444	missense	probably damaging	1.00
IGL03269:Tlr4	APN	4	66840796	missense	probably damaging	1.00
IGL03288:Tlr4	APN	4	66839753	missense	probably damaging	0.99
bugsy	UTSW	4	66839254	nonsense	probably null
Cruyff	UTSW	4	66840326	missense	probably damaging	1.00
don_knotts	UTSW	4	66841172	missense	probably damaging	1.00
Guardiola	UTSW	4	66839303	missense	probably damaging	1.00
Lops	UTSW	4	66833880	splice site	probably null
lps3	UTSW	4	66841097	missense	probably damaging	1.00
Lps4	UTSW	4	66841142	missense	probably damaging	1.00
milquetoast	UTSW	4	66839444	missense	probably damaging	1.00
salvador	UTSW	4	66840206	missense	probably damaging	0.99
R0449:Tlr4	UTSW	4	66839620	missense	probably damaging	0.99
R0576:Tlr4	UTSW	4	66839495	missense	probably benign	0.00
R0827:Tlr4	UTSW	4	66833880	splice site	probably null
R1488:Tlr4	UTSW	4	66839549	missense	probably damaging	1.00
R1490:Tlr4	UTSW	4	66839374	missense	possibly damaging	0.56
R1522:Tlr4	UTSW	4	66839696	missense	possibly damaging	0.80
R1616:Tlr4	UTSW	4	66839480	missense	probably damaging	1.00
R1681:Tlr4	UTSW	4	66841105	missense	probably damaging	1.00
R1738:Tlr4	UTSW	4	66841076	missense	probably benign	0.19
R1888:Tlr4	UTSW	4	66841172	missense	probably damaging	1.00
R1888:Tlr4	UTSW	4	66841172	missense	probably damaging	1.00
R1929:Tlr4	UTSW	4	66839444	missense	probably damaging	1.00
R1982:Tlr4	UTSW	4	66841035	missense	probably benign	0.40
R1998:Tlr4	UTSW	4	66840470	missense	probably damaging	1.00
R2186:Tlr4	UTSW	4	66839983	missense	possibly damaging	0.63
R2305:Tlr4	UTSW	4	66840101	missense	probably damaging	1.00
R3011:Tlr4	UTSW	4	66839254	nonsense	probably null
R3420:Tlr4	UTSW	4	66839536	missense	probably benign	0.37
R3422:Tlr4	UTSW	4	66839536	missense	probably benign	0.37
R3818:Tlr4	UTSW	4	66841316	missense	probably benign	0.00
R4212:Tlr4	UTSW	4	66840326	missense	probably damaging	1.00
R4213:Tlr4	UTSW	4	66840326	missense	probably damaging	1.00
R4417:Tlr4	UTSW	4	66839303	missense	probably damaging	1.00
R4630:Tlr4	UTSW	4	66839240	missense	probably benign	0.44
R4735:Tlr4	UTSW	4	66841198	missense	probably damaging	1.00
R5191:Tlr4	UTSW	4	66841379	missense	probably damaging	0.96
R5613:Tlr4	UTSW	4	66840885	missense	possibly damaging	0.94
R5705:Tlr4	UTSW	4	66833980	missense	probably damaging	1.00
R5726:Tlr4	UTSW	4	66840415	missense	probably benign
R6021:Tlr4	UTSW	4	66840866	missense	probably damaging	1.00
R6159:Tlr4	UTSW	4	66839833	missense	possibly damaging	0.92
R6227:Tlr4	UTSW	4	66840595	missense	probably benign
R7139:Tlr4	UTSW	4	66840283	missense	probably benign	0.06
R7199:Tlr4	UTSW	4	66841193	missense	probably damaging	0.99
R7220:Tlr4	UTSW	4	66839951	missense	probably benign
R7337:Tlr4	UTSW	4	66839954	missense	possibly damaging	0.86
R7487:Tlr4	UTSW	4	66924422	missense	probably benign	0.00
R7638:Tlr4	UTSW	4	66840206	missense	probably damaging	0.99
R7773:Tlr4	UTSW	4	66839599	missense	probably damaging	1.00
R7814:Tlr4	UTSW	4	66841079	missense	probably damaging	1.00
R7897:Tlr4	UTSW	4	66839821	missense	probably benign	0.07
R8044:Tlr4	UTSW	4	66827847	missense	probably benign	0.01
R8062:Tlr4	UTSW	4	66839850	missense	probably benign	0.00
R8080:Tlr4	UTSW	4	66839476	missense	probably damaging	1.00
R8446:Tlr4	UTSW	4	66839436	missense	probably damaging	0.98
R8916:Tlr4	UTSW	4	66929031	missense	probably benign	0.06
R9100:Tlr4	UTSW	4	66840281	missense	probably benign	0.08
R9415:Tlr4	UTSW	4	66827923	critical splice donor site	probably null
X0064:Tlr4	UTSW	4	66840140	missense	probably damaging	0.99
Z1088:Tlr4	UTSW	4	66929082	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ATGCTAAGGTTGGCACTCTCACTTC -3'
(R):5'- TGATTACAGTCATGCTTTCGTCCCG -3'

Sequencing Primer
(F):5'- TATAGTACTTGCAGAGGGGCAC -3'
(R):5'- ttcagtaagttctttaacgactctc -3'

Posted On

2013-05-23