Mutagenetix > Incidental Mutations

Incidental Mutation 'R5470:Chd8'

433490

Institutional Source

Beutler Lab

Gene Symbol

Chd8

Ensembl Gene

ENSMUSG00000053754

Gene Name

chromodomain helicase DNA binding protein 8

Synonyms

Duplin, 5830451P18Rik

MMRRC Submission

043031-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5470 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52198151-52257780 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 52212609 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 154 (F154L)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089752] [ENSMUST00000149975] [ENSMUST00000200169]

Predicted Effect

probably benign
Transcript: ENSMUST00000089752
AA Change: F1563L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000087184
Gene: ENSMUSG00000053754
AA Change: F1563L

Domain	Start	End	E-Value	Type
low complexity region	255	272	N/A	INTRINSIC
low complexity region	340	374	N/A	INTRINSIC
low complexity region	404	437	N/A	INTRINSIC
low complexity region	463	477	N/A	INTRINSIC
low complexity region	497	534	N/A	INTRINSIC
low complexity region	588	607	N/A	INTRINSIC
CHROMO	642	708	1.8e-9	SMART
CHROMO	724	782	1.55e-4	SMART
DEXDc	809	1011	4.13e-37	SMART
HELICc	1165	1249	1.01e-22	SMART
low complexity region	1335	1345	N/A	INTRINSIC
low complexity region	1422	1441	N/A	INTRINSIC
Blast:DEXDc	1460	1505	4e-16	BLAST
low complexity region	1579	1590	N/A	INTRINSIC
low complexity region	1703	1714	N/A	INTRINSIC
low complexity region	1770	1785	N/A	INTRINSIC
low complexity region	1887	1903	N/A	INTRINSIC
low complexity region	2063	2107	N/A	INTRINSIC
low complexity region	2222	2239	N/A	INTRINSIC
BRK	2312	2356	1.34e-19	SMART
BRK	2381	2421	1.94e-2	SMART
low complexity region	2452	2472	N/A	INTRINSIC
low complexity region	2494	2510	N/A	INTRINSIC
low complexity region	2514	2529	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122823

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136528

Predicted Effect

probably damaging
Transcript: ENSMUST00000140603
AA Change: F154L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000118494
Gene: ENSMUSG00000053754
AA Change: F154L

Domain	Start	End	E-Value	Type
low complexity region	6	25	N/A	INTRINSIC
Blast:DEXDc	44	167	3e-43	BLAST
low complexity region	171	182	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145404

Predicted Effect

probably benign
Transcript: ENSMUST00000149975
AA Change: F223L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000122995
Gene: ENSMUSG00000053754
AA Change: F223L

Domain	Start	End	E-Value	Type
low complexity region	74	93	N/A	INTRINSIC
Blast:DEXDc	112	235	9e-40	BLAST
low complexity region	239	250	N/A	INTRINSIC
low complexity region	363	374	N/A	INTRINSIC
low complexity region	430	445	N/A	INTRINSIC
Blast:SANT	456	515	1e-29	BLAST
low complexity region	547	563	N/A	INTRINSIC
low complexity region	723	767	N/A	INTRINSIC
low complexity region	882	899	N/A	INTRINSIC
BRK	972	1016	1.34e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155614

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175303

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180857

Predicted Effect

probably benign
Transcript: ENSMUST00000200169
AA Change: F1563L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000142890
Gene: ENSMUSG00000053754
AA Change: F1563L

Domain	Start	End	E-Value	Type
low complexity region	255	272	N/A	INTRINSIC
low complexity region	340	374	N/A	INTRINSIC
low complexity region	404	437	N/A	INTRINSIC
low complexity region	463	477	N/A	INTRINSIC
low complexity region	497	534	N/A	INTRINSIC
low complexity region	588	607	N/A	INTRINSIC
CHROMO	642	708	1.8e-9	SMART
CHROMO	724	782	1.55e-4	SMART
DEXDc	809	1011	4.13e-37	SMART
HELICc	1165	1249	1.01e-22	SMART
low complexity region	1335	1345	N/A	INTRINSIC
low complexity region	1422	1441	N/A	INTRINSIC
Blast:DEXDc	1460	1505	4e-16	BLAST
low complexity region	1579	1590	N/A	INTRINSIC
low complexity region	1703	1714	N/A	INTRINSIC
low complexity region	1770	1785	N/A	INTRINSIC
low complexity region	1887	1903	N/A	INTRINSIC
low complexity region	2063	2107	N/A	INTRINSIC
low complexity region	2222	2239	N/A	INTRINSIC
BRK	2312	2356	1.34e-19	SMART
BRK	2381	2421	1.94e-2	SMART
low complexity region	2452	2472	N/A	INTRINSIC
low complexity region	2494	2510	N/A	INTRINSIC
low complexity region	2514	2529	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227448

Meta Mutation Damage Score

0.0754

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.1%
20x: 90.4%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain-helicase-DNA binding protein family, which is characterized by a SNF2-like domain and two chromatin organization modifier domains. The encoded protein also contains brahma and kismet domains, which is common to the subfamily of chromodomain-helicase-DNA binding proteins to which this protein belongs. In mammals, this gene has been shown to function in several processes including transcriptional regulation, epigenetic remodeling, promotion of cell proliferation, and regulation of RNA synthesis. Knockout of this gene causes early embryonic lethality due to widespread apoptosis. Heterozygous loss of function mutations result in autism spectrum disorder-like behaviors that include increased anxiety, repetitive behavior, and altered social behavior. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null embryos are growth retarded starting at E5.5 and exhibit developmental arrest at E6.5. Mutants develop into an egg cylinder but do not form a primitive streak or mesoderm and exhibit increased apoptosis at E7.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn1	T	A	12: 80,168,941	I813F	probably damaging	Het
Aqr	G	A	2: 114,157,575	L169F	probably damaging	Het
Atp6v1d	G	A	12: 78,845,284	R182C	probably benign	Het
Bcl2l13	G	T	6: 120,862,872	A44S	probably benign	Het
Brip1	T	C	11: 86,148,542	K389E	possibly damaging	Het
C530025M09Rik	G	A	2: 149,831,125		probably benign	Het
Ccdc7b	T	A	8: 129,072,600	S53T	possibly damaging	Het
Cop1	A	T	1: 159,266,860		probably benign	Het
Cyp2c39	A	G	19: 39,513,530	K121R	possibly damaging	Het
Cyp3a57	A	G	5: 145,372,619	M256V	probably benign	Het
Deup1	T	C	9: 15,582,620		probably null	Het
Dnah10	A	G	5: 124,753,168	N709D	probably benign	Het
Dthd1	A	G	5: 62,818,766	Y261C	probably damaging	Het
Ear-ps2	G	A	14: 44,047,060		noncoding transcript	Het
En2	C	T	5: 28,166,924	T133M	probably benign	Het
Endou	A	G	15: 97,718,955	F229S	probably damaging	Het
Etl4	A	T	2: 20,529,980	H79L	probably damaging	Het
Fah	C	T	7: 84,593,185		probably null	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Fignl1	T	A	11: 11,802,640	E138D	probably benign	Het
Fndc3a	A	G	14: 72,574,568	L311P	possibly damaging	Het
Gdf9	T	A	11: 53,436,754	V179E	probably benign	Het
Gm14129	G	T	2: 148,927,817		noncoding transcript	Het
Gorab	A	G	1: 163,392,509	I188T	probably damaging	Het
Gpr152	G	A	19: 4,143,129	C223Y	probably damaging	Het
Heatr5b	A	T	17: 78,821,579		probably null	Het
Hsd17b3	G	T	13: 64,073,899	T104N	probably damaging	Het
Il6ra	C	T	3: 89,885,995	V283M	probably benign	Het
Klk1b16	A	T	7: 44,137,331	I5F	probably damaging	Het
Krt74	G	A	15: 101,754,465		noncoding transcript	Het
Lrch3	T	A	16: 32,998,590	N650K	probably damaging	Het
Ly96	A	T	1: 16,709,486	E126D	probably benign	Het
Mgarp	C	A	3: 51,391,285	R66L	possibly damaging	Het
Naalad2	T	A	9: 18,330,851	T586S	probably damaging	Het
Ndufaf3	T	C	9: 108,566,444		probably benign	Het
Neb	A	G	2: 52,249,438	M3055T	possibly damaging	Het
Neo1	G	T	9: 58,931,067	A478D	probably damaging	Het
Nmrk1	A	T	19: 18,639,884		probably null	Het
Nsl1	T	C	1: 191,080,540	M184T	probably benign	Het
Nup133	T	C	8: 123,930,966	N410S	probably benign	Het
Olfr23	T	C	11: 73,940,870	I208T	probably benign	Het
Olfr399	A	G	11: 74,053,907	I284T	possibly damaging	Het
Olfr610	T	G	7: 103,506,509	I146L	probably benign	Het
Opalin	A	G	19: 41,066,531	S75P	probably benign	Het
Palb2	C	A	7: 122,114,351	C903F	probably damaging	Het
Pcm1	T	A	8: 41,287,683	W989R	probably damaging	Het
Pfkfb4	T	A	9: 109,027,593	I389N	probably damaging	Het
Pitrm1	T	C	13: 6,553,270	C119R	probably benign	Het
Plekha1	T	C	7: 130,908,376	V45A	probably damaging	Het
Pold2	G	A	11: 5,873,048	P376S	probably damaging	Het
Rcan2	A	G	17: 43,836,283	D4G	probably benign	Het
Slc12a1	A	T	2: 125,170,714	T299S	probably damaging	Het
Slc22a29	A	T	19: 8,161,516	H527Q	probably benign	Het
Slc22a8	G	A	19: 8,607,870	R261H	probably damaging	Het
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Slco4a1	T	C	2: 180,474,114	F681S	probably benign	Het
Sorcs2	A	T	5: 36,031,183	H860Q	probably benign	Het
Strn	A	T	17: 78,656,945	H530Q	probably benign	Het
Tex14	A	G	11: 87,551,604	R179G	probably damaging	Het
Tjp3	T	C	10: 81,279,547	D350G	probably benign	Het
Tnrc6b	G	T	15: 80,916,711	R1406L	possibly damaging	Het
Tnxb	A	G	17: 34,716,973	D2666G	probably null	Het
Ttn	A	T	2: 76,729,864	Y27652N	probably benign	Het
Utp20	T	A	10: 88,817,896	E287D	probably benign	Het
Vmn1r45	T	C	6: 89,933,716	I91V	probably benign	Het
Wdr72	A	T	9: 74,139,699	K76*	probably null	Het
Zfp689	C	T	7: 127,444,253	A402T	probably damaging	Het
Zfpm1	A	G	8: 122,333,793	E207G	probably damaging	Het
Zhx2	G	T	15: 57,823,074	R613L	possibly damaging	Het

Other mutations in Chd8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Chd8	APN	14	52226138	missense	probably damaging	0.99
IGL00694:Chd8	APN	14	52217970	missense	probably damaging	1.00
IGL01011:Chd8	APN	14	52231532	missense	possibly damaging	0.86
IGL01022:Chd8	APN	14	52236993	missense	probably benign
IGL01066:Chd8	APN	14	52217766	missense	probably damaging	1.00
IGL01083:Chd8	APN	14	52221420	missense	probably damaging	1.00
IGL01313:Chd8	APN	14	52210575	missense	probably damaging	1.00
IGL01396:Chd8	APN	14	52204587	unclassified	probably benign
IGL01476:Chd8	APN	14	52205490	missense	probably benign	0.32
IGL01731:Chd8	APN	14	52212654	missense	probably benign	0.12
IGL01895:Chd8	APN	14	52199094	missense	probably benign	0.00
IGL02090:Chd8	APN	14	52227234	critical splice donor site	probably null
IGL02344:Chd8	APN	14	52201650	missense	probably damaging	1.00
IGL02573:Chd8	APN	14	52219734	missense	possibly damaging	0.95
IGL02601:Chd8	APN	14	52214300	missense	possibly damaging	0.94
IGL02617:Chd8	APN	14	52235191	missense	probably benign	0.34
IGL02873:Chd8	APN	14	52222513	missense	probably damaging	0.99
IGL02974:Chd8	APN	14	52201701	splice site	probably null
IGL03058:Chd8	APN	14	52218273	missense	probably damaging	1.00
IGL03076:Chd8	APN	14	52226162	splice site	probably benign
IGL03239:Chd8	APN	14	52227548	missense	possibly damaging	0.92
PIT4431001:Chd8	UTSW	14	52218249	missense	probably damaging	0.98
PIT4468001:Chd8	UTSW	14	52207996	missense	probably benign
PIT4468001:Chd8	UTSW	14	52217881	missense	possibly damaging	0.95
R0006:Chd8	UTSW	14	52235293	missense	possibly damaging	0.51
R0006:Chd8	UTSW	14	52235293	missense	possibly damaging	0.51
R0022:Chd8	UTSW	14	52232855	missense	probably benign	0.00
R0115:Chd8	UTSW	14	52237206	missense	probably benign	0.00
R0131:Chd8	UTSW	14	52205326	missense	probably benign	0.15
R0131:Chd8	UTSW	14	52205326	missense	probably benign	0.15
R0132:Chd8	UTSW	14	52205326	missense	probably benign	0.15
R0419:Chd8	UTSW	14	52204060	missense	probably benign	0.24
R0440:Chd8	UTSW	14	52204826	missense	possibly damaging	0.91
R0452:Chd8	UTSW	14	52214587	missense	probably damaging	1.00
R0481:Chd8	UTSW	14	52237206	missense	probably benign	0.00
R0624:Chd8	UTSW	14	52219757	missense	possibly damaging	0.65
R0650:Chd8	UTSW	14	52202304	missense	probably benign	0.09
R0691:Chd8	UTSW	14	52213433	missense	probably damaging	0.96
R0790:Chd8	UTSW	14	52204025	missense	probably benign	0.07
R0835:Chd8	UTSW	14	52204025	missense	probably benign	0.07
R1180:Chd8	UTSW	14	52221108	missense	probably damaging	1.00
R1411:Chd8	UTSW	14	52224646	missense	probably benign
R1725:Chd8	UTSW	14	52232573	missense	probably benign	0.08
R1838:Chd8	UTSW	14	52204883	missense	probably benign	0.11
R1839:Chd8	UTSW	14	52204883	missense	probably benign	0.11
R1968:Chd8	UTSW	14	52220993	missense	probably damaging	0.98
R2020:Chd8	UTSW	14	52215241	missense	probably damaging	1.00
R2024:Chd8	UTSW	14	52231493	missense	probably benign	0.23
R2139:Chd8	UTSW	14	52236971	missense	probably benign	0.32
R2163:Chd8	UTSW	14	52198818	missense	possibly damaging	0.53
R2342:Chd8	UTSW	14	52205217	missense	probably benign	0.25
R2844:Chd8	UTSW	14	52204495	missense	possibly damaging	0.92
R3500:Chd8	UTSW	14	52205653	missense	probably benign	0.00
R3861:Chd8	UTSW	14	52237121	missense	probably benign	0.13
R4154:Chd8	UTSW	14	52207211	unclassified	probably benign
R4445:Chd8	UTSW	14	52204527	splice site	probably null
R4628:Chd8	UTSW	14	52206915	missense	probably benign	0.03
R4779:Chd8	UTSW	14	52231506	missense	probably damaging	1.00
R4783:Chd8	UTSW	14	52205368	missense	probably damaging	1.00
R4784:Chd8	UTSW	14	52205368	missense	probably damaging	1.00
R5001:Chd8	UTSW	14	52203915	missense	probably benign	0.09
R5280:Chd8	UTSW	14	52205125	missense	possibly damaging	0.68
R5331:Chd8	UTSW	14	52202114	intron	probably benign
R5348:Chd8	UTSW	14	52232698	missense	probably damaging	1.00
R5375:Chd8	UTSW	14	52204154	missense	probably damaging	1.00
R5479:Chd8	UTSW	14	52215195	missense	probably benign	0.15
R5488:Chd8	UTSW	14	52213048	intron	probably benign
R5489:Chd8	UTSW	14	52213048	intron	probably benign
R5499:Chd8	UTSW	14	52204431	critical splice donor site	probably null
R5988:Chd8	UTSW	14	52217938	missense	probably damaging	1.00
R6046:Chd8	UTSW	14	52221071	missense	possibly damaging	0.60
R6125:Chd8	UTSW	14	52207034	missense	probably benign	0.16
R6212:Chd8	UTSW	14	52201698	missense	probably damaging	1.00
R6337:Chd8	UTSW	14	52204109	missense	probably damaging	1.00
R6394:Chd8	UTSW	14	52202585	missense	possibly damaging	0.66
R6576:Chd8	UTSW	14	52216076	missense	probably damaging	1.00
R6590:Chd8	UTSW	14	52227237	missense	possibly damaging	0.60
R6690:Chd8	UTSW	14	52227237	missense	possibly damaging	0.60
R6786:Chd8	UTSW	14	52226668	missense	probably benign	0.33
R6913:Chd8	UTSW	14	52214494	missense	probably damaging	0.99
R7090:Chd8	UTSW	14	52215220	missense	probably damaging	0.99
R7107:Chd8	UTSW	14	52212672	missense	probably benign	0.07
R7138:Chd8	UTSW	14	52214498	missense	possibly damaging	0.83
R7383:Chd8	UTSW	14	52215319	missense	probably damaging	1.00
R7392:Chd8	UTSW	14	52232855	missense	probably benign
R7471:Chd8	UTSW	14	52204112	missense	probably benign
R7625:Chd8	UTSW	14	52237077	missense	probably benign	0.04
R7790:Chd8	UTSW	14	52226082	missense	probably damaging	1.00
R7862:Chd8	UTSW	14	52214277	missense	probably damaging	1.00
R7937:Chd8	UTSW	14	52227506	missense	probably benign	0.02
R8092:Chd8	UTSW	14	52217727	missense	probably damaging	1.00
R8237:Chd8	UTSW	14	52213352	missense	probably damaging	1.00
R8321:Chd8	UTSW	14	52232567	missense	probably benign	0.01
R8371:Chd8	UTSW	14	52232818	missense	probably benign
R8425:Chd8	UTSW	14	52210555	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTATGGCACCTCCTAACAC -3'
(R):5'- ACCTCTCCACAGGGTTTCTAG -3'

Sequencing Primer
(F):5'- CTGCCTGGTCTCCAATAACC -3'
(R):5'- ACAGGGTTTCTAGTCCTTTTCAG -3'

Posted On

2016-10-06