Incidental Mutation 'R5470:Chd8'
ID433490
Institutional Source Beutler Lab
Gene Symbol Chd8
Ensembl Gene ENSMUSG00000053754
Gene Namechromodomain helicase DNA binding protein 8
SynonymsDuplin, 5830451P18Rik
MMRRC Submission 043031-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5470 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location52198151-52257780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52212609 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 154 (F154L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089752] [ENSMUST00000149975] [ENSMUST00000200169]
Predicted Effect probably benign
Transcript: ENSMUST00000089752
AA Change: F1563L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000087184
Gene: ENSMUSG00000053754
AA Change: F1563L

DomainStartEndE-ValueType
low complexity region 255 272 N/A INTRINSIC
low complexity region 340 374 N/A INTRINSIC
low complexity region 404 437 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 534 N/A INTRINSIC
low complexity region 588 607 N/A INTRINSIC
CHROMO 642 708 1.8e-9 SMART
CHROMO 724 782 1.55e-4 SMART
DEXDc 809 1011 4.13e-37 SMART
HELICc 1165 1249 1.01e-22 SMART
low complexity region 1335 1345 N/A INTRINSIC
low complexity region 1422 1441 N/A INTRINSIC
Blast:DEXDc 1460 1505 4e-16 BLAST
low complexity region 1579 1590 N/A INTRINSIC
low complexity region 1703 1714 N/A INTRINSIC
low complexity region 1770 1785 N/A INTRINSIC
low complexity region 1887 1903 N/A INTRINSIC
low complexity region 2063 2107 N/A INTRINSIC
low complexity region 2222 2239 N/A INTRINSIC
BRK 2312 2356 1.34e-19 SMART
BRK 2381 2421 1.94e-2 SMART
low complexity region 2452 2472 N/A INTRINSIC
low complexity region 2494 2510 N/A INTRINSIC
low complexity region 2514 2529 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136528
Predicted Effect probably damaging
Transcript: ENSMUST00000140603
AA Change: F154L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118494
Gene: ENSMUSG00000053754
AA Change: F154L

DomainStartEndE-ValueType
low complexity region 6 25 N/A INTRINSIC
Blast:DEXDc 44 167 3e-43 BLAST
low complexity region 171 182 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145404
Predicted Effect probably benign
Transcript: ENSMUST00000149975
AA Change: F223L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000122995
Gene: ENSMUSG00000053754
AA Change: F223L

DomainStartEndE-ValueType
low complexity region 74 93 N/A INTRINSIC
Blast:DEXDc 112 235 9e-40 BLAST
low complexity region 239 250 N/A INTRINSIC
low complexity region 363 374 N/A INTRINSIC
low complexity region 430 445 N/A INTRINSIC
Blast:SANT 456 515 1e-29 BLAST
low complexity region 547 563 N/A INTRINSIC
low complexity region 723 767 N/A INTRINSIC
low complexity region 882 899 N/A INTRINSIC
BRK 972 1016 1.34e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155614
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175303
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180857
Predicted Effect probably benign
Transcript: ENSMUST00000200169
AA Change: F1563L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000142890
Gene: ENSMUSG00000053754
AA Change: F1563L

DomainStartEndE-ValueType
low complexity region 255 272 N/A INTRINSIC
low complexity region 340 374 N/A INTRINSIC
low complexity region 404 437 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 534 N/A INTRINSIC
low complexity region 588 607 N/A INTRINSIC
CHROMO 642 708 1.8e-9 SMART
CHROMO 724 782 1.55e-4 SMART
DEXDc 809 1011 4.13e-37 SMART
HELICc 1165 1249 1.01e-22 SMART
low complexity region 1335 1345 N/A INTRINSIC
low complexity region 1422 1441 N/A INTRINSIC
Blast:DEXDc 1460 1505 4e-16 BLAST
low complexity region 1579 1590 N/A INTRINSIC
low complexity region 1703 1714 N/A INTRINSIC
low complexity region 1770 1785 N/A INTRINSIC
low complexity region 1887 1903 N/A INTRINSIC
low complexity region 2063 2107 N/A INTRINSIC
low complexity region 2222 2239 N/A INTRINSIC
BRK 2312 2356 1.34e-19 SMART
BRK 2381 2421 1.94e-2 SMART
low complexity region 2452 2472 N/A INTRINSIC
low complexity region 2494 2510 N/A INTRINSIC
low complexity region 2514 2529 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227448
Meta Mutation Damage Score 0.0754 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain-helicase-DNA binding protein family, which is characterized by a SNF2-like domain and two chromatin organization modifier domains. The encoded protein also contains brahma and kismet domains, which is common to the subfamily of chromodomain-helicase-DNA binding proteins to which this protein belongs. In mammals, this gene has been shown to function in several processes including transcriptional regulation, epigenetic remodeling, promotion of cell proliferation, and regulation of RNA synthesis. Knockout of this gene causes early embryonic lethality due to widespread apoptosis. Heterozygous loss of function mutations result in autism spectrum disorder-like behaviors that include increased anxiety, repetitive behavior, and altered social behavior. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null embryos are growth retarded starting at E5.5 and exhibit developmental arrest at E6.5. Mutants develop into an egg cylinder but do not form a primitive streak or mesoderm and exhibit increased apoptosis at E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,168,941 I813F probably damaging Het
Aqr G A 2: 114,157,575 L169F probably damaging Het
Atp6v1d G A 12: 78,845,284 R182C probably benign Het
Bcl2l13 G T 6: 120,862,872 A44S probably benign Het
Brip1 T C 11: 86,148,542 K389E possibly damaging Het
C530025M09Rik G A 2: 149,831,125 probably benign Het
Ccdc7b T A 8: 129,072,600 S53T possibly damaging Het
Cop1 A T 1: 159,266,860 probably benign Het
Cyp2c39 A G 19: 39,513,530 K121R possibly damaging Het
Cyp3a57 A G 5: 145,372,619 M256V probably benign Het
Deup1 T C 9: 15,582,620 probably null Het
Dnah10 A G 5: 124,753,168 N709D probably benign Het
Dthd1 A G 5: 62,818,766 Y261C probably damaging Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
En2 C T 5: 28,166,924 T133M probably benign Het
Endou A G 15: 97,718,955 F229S probably damaging Het
Etl4 A T 2: 20,529,980 H79L probably damaging Het
Fah C T 7: 84,593,185 probably null Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fignl1 T A 11: 11,802,640 E138D probably benign Het
Fndc3a A G 14: 72,574,568 L311P possibly damaging Het
Gdf9 T A 11: 53,436,754 V179E probably benign Het
Gm14129 G T 2: 148,927,817 noncoding transcript Het
Gorab A G 1: 163,392,509 I188T probably damaging Het
Gpr152 G A 19: 4,143,129 C223Y probably damaging Het
Heatr5b A T 17: 78,821,579 probably null Het
Hsd17b3 G T 13: 64,073,899 T104N probably damaging Het
Il6ra C T 3: 89,885,995 V283M probably benign Het
Klk1b16 A T 7: 44,137,331 I5F probably damaging Het
Krt74 G A 15: 101,754,465 noncoding transcript Het
Lrch3 T A 16: 32,998,590 N650K probably damaging Het
Ly96 A T 1: 16,709,486 E126D probably benign Het
Mgarp C A 3: 51,391,285 R66L possibly damaging Het
Naalad2 T A 9: 18,330,851 T586S probably damaging Het
Ndufaf3 T C 9: 108,566,444 probably benign Het
Neb A G 2: 52,249,438 M3055T possibly damaging Het
Neo1 G T 9: 58,931,067 A478D probably damaging Het
Nmrk1 A T 19: 18,639,884 probably null Het
Nsl1 T C 1: 191,080,540 M184T probably benign Het
Nup133 T C 8: 123,930,966 N410S probably benign Het
Olfr23 T C 11: 73,940,870 I208T probably benign Het
Olfr399 A G 11: 74,053,907 I284T possibly damaging Het
Olfr610 T G 7: 103,506,509 I146L probably benign Het
Opalin A G 19: 41,066,531 S75P probably benign Het
Palb2 C A 7: 122,114,351 C903F probably damaging Het
Pcm1 T A 8: 41,287,683 W989R probably damaging Het
Pfkfb4 T A 9: 109,027,593 I389N probably damaging Het
Pitrm1 T C 13: 6,553,270 C119R probably benign Het
Plekha1 T C 7: 130,908,376 V45A probably damaging Het
Pold2 G A 11: 5,873,048 P376S probably damaging Het
Rcan2 A G 17: 43,836,283 D4G probably benign Het
Slc12a1 A T 2: 125,170,714 T299S probably damaging Het
Slc22a29 A T 19: 8,161,516 H527Q probably benign Het
Slc22a8 G A 19: 8,607,870 R261H probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slco4a1 T C 2: 180,474,114 F681S probably benign Het
Sorcs2 A T 5: 36,031,183 H860Q probably benign Het
Strn A T 17: 78,656,945 H530Q probably benign Het
Tex14 A G 11: 87,551,604 R179G probably damaging Het
Tjp3 T C 10: 81,279,547 D350G probably benign Het
Tnrc6b G T 15: 80,916,711 R1406L possibly damaging Het
Tnxb A G 17: 34,716,973 D2666G probably null Het
Ttn A T 2: 76,729,864 Y27652N probably benign Het
Utp20 T A 10: 88,817,896 E287D probably benign Het
Vmn1r45 T C 6: 89,933,716 I91V probably benign Het
Wdr72 A T 9: 74,139,699 K76* probably null Het
Zfp689 C T 7: 127,444,253 A402T probably damaging Het
Zfpm1 A G 8: 122,333,793 E207G probably damaging Het
Zhx2 G T 15: 57,823,074 R613L possibly damaging Het
Other mutations in Chd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Chd8 APN 14 52226138 missense probably damaging 0.99
IGL00694:Chd8 APN 14 52217970 missense probably damaging 1.00
IGL01011:Chd8 APN 14 52231532 missense possibly damaging 0.86
IGL01022:Chd8 APN 14 52236993 missense probably benign
IGL01066:Chd8 APN 14 52217766 missense probably damaging 1.00
IGL01083:Chd8 APN 14 52221420 missense probably damaging 1.00
IGL01313:Chd8 APN 14 52210575 missense probably damaging 1.00
IGL01396:Chd8 APN 14 52204587 unclassified probably benign
IGL01476:Chd8 APN 14 52205490 missense probably benign 0.32
IGL01731:Chd8 APN 14 52212654 missense probably benign 0.12
IGL01895:Chd8 APN 14 52199094 missense probably benign 0.00
IGL02090:Chd8 APN 14 52227234 critical splice donor site probably null
IGL02344:Chd8 APN 14 52201650 missense probably damaging 1.00
IGL02573:Chd8 APN 14 52219734 missense possibly damaging 0.95
IGL02601:Chd8 APN 14 52214300 missense possibly damaging 0.94
IGL02617:Chd8 APN 14 52235191 missense probably benign 0.34
IGL02873:Chd8 APN 14 52222513 missense probably damaging 0.99
IGL02974:Chd8 APN 14 52201701 unclassified probably null
IGL03058:Chd8 APN 14 52218273 missense probably damaging 1.00
IGL03076:Chd8 APN 14 52226162 splice site probably benign
IGL03239:Chd8 APN 14 52227548 missense possibly damaging 0.92
PIT4431001:Chd8 UTSW 14 52218249 missense probably damaging 0.98
PIT4468001:Chd8 UTSW 14 52207996 missense probably benign
PIT4468001:Chd8 UTSW 14 52217881 missense possibly damaging 0.95
R0006:Chd8 UTSW 14 52235293 missense possibly damaging 0.51
R0006:Chd8 UTSW 14 52235293 missense possibly damaging 0.51
R0022:Chd8 UTSW 14 52232855 missense probably benign 0.00
R0115:Chd8 UTSW 14 52237206 missense probably benign 0.00
R0131:Chd8 UTSW 14 52205326 missense probably benign 0.15
R0131:Chd8 UTSW 14 52205326 missense probably benign 0.15
R0132:Chd8 UTSW 14 52205326 missense probably benign 0.15
R0419:Chd8 UTSW 14 52204060 missense probably benign 0.24
R0440:Chd8 UTSW 14 52204826 missense possibly damaging 0.91
R0452:Chd8 UTSW 14 52214587 missense probably damaging 1.00
R0481:Chd8 UTSW 14 52237206 missense probably benign 0.00
R0624:Chd8 UTSW 14 52219757 missense possibly damaging 0.65
R0650:Chd8 UTSW 14 52202304 missense probably benign 0.09
R0691:Chd8 UTSW 14 52213433 missense probably damaging 0.96
R0790:Chd8 UTSW 14 52204025 missense probably benign 0.07
R0835:Chd8 UTSW 14 52204025 missense probably benign 0.07
R1180:Chd8 UTSW 14 52221108 missense probably damaging 1.00
R1411:Chd8 UTSW 14 52224646 missense probably benign
R1725:Chd8 UTSW 14 52232573 missense probably benign 0.08
R1838:Chd8 UTSW 14 52204883 missense probably benign 0.11
R1839:Chd8 UTSW 14 52204883 missense probably benign 0.11
R1968:Chd8 UTSW 14 52220993 missense probably damaging 0.98
R2020:Chd8 UTSW 14 52215241 missense probably damaging 1.00
R2024:Chd8 UTSW 14 52231493 missense probably benign 0.23
R2139:Chd8 UTSW 14 52236971 missense probably benign 0.32
R2163:Chd8 UTSW 14 52198818 missense possibly damaging 0.53
R2342:Chd8 UTSW 14 52205217 missense probably benign 0.25
R2844:Chd8 UTSW 14 52204495 missense possibly damaging 0.92
R3500:Chd8 UTSW 14 52205653 missense probably benign 0.00
R3861:Chd8 UTSW 14 52237121 missense probably benign 0.13
R4154:Chd8 UTSW 14 52207211 unclassified probably benign
R4445:Chd8 UTSW 14 52204527 unclassified probably null
R4628:Chd8 UTSW 14 52206915 missense probably benign 0.03
R4779:Chd8 UTSW 14 52231506 missense probably damaging 1.00
R4783:Chd8 UTSW 14 52205368 missense probably damaging 1.00
R4784:Chd8 UTSW 14 52205368 missense probably damaging 1.00
R5001:Chd8 UTSW 14 52203915 missense probably benign 0.09
R5280:Chd8 UTSW 14 52205125 missense possibly damaging 0.68
R5331:Chd8 UTSW 14 52202114 intron probably benign
R5348:Chd8 UTSW 14 52232698 missense probably damaging 1.00
R5375:Chd8 UTSW 14 52204154 missense probably damaging 1.00
R5479:Chd8 UTSW 14 52215195 missense probably benign 0.15
R5488:Chd8 UTSW 14 52213048 intron probably benign
R5489:Chd8 UTSW 14 52213048 intron probably benign
R5499:Chd8 UTSW 14 52204431 critical splice donor site probably null
R5988:Chd8 UTSW 14 52217938 missense probably damaging 1.00
R6046:Chd8 UTSW 14 52221071 missense possibly damaging 0.60
R6125:Chd8 UTSW 14 52207034 missense probably benign 0.16
R6212:Chd8 UTSW 14 52201698 missense probably damaging 1.00
R6337:Chd8 UTSW 14 52204109 missense probably damaging 1.00
R6394:Chd8 UTSW 14 52202585 missense possibly damaging 0.66
R6576:Chd8 UTSW 14 52216076 missense probably damaging 1.00
R6590:Chd8 UTSW 14 52227237 missense possibly damaging 0.60
R6690:Chd8 UTSW 14 52227237 missense possibly damaging 0.60
R6786:Chd8 UTSW 14 52226668 missense probably benign 0.33
R6913:Chd8 UTSW 14 52214494 missense probably damaging 0.99
R7090:Chd8 UTSW 14 52215220 missense probably damaging 0.99
R7107:Chd8 UTSW 14 52212672 missense probably benign 0.07
R7138:Chd8 UTSW 14 52214498 missense possibly damaging 0.83
R7383:Chd8 UTSW 14 52215319 missense probably damaging 1.00
R7392:Chd8 UTSW 14 52232855 missense probably benign
R7471:Chd8 UTSW 14 52204112 missense probably benign
R7625:Chd8 UTSW 14 52237077 missense probably benign 0.04
R7790:Chd8 UTSW 14 52226082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTATGGCACCTCCTAACAC -3'
(R):5'- ACCTCTCCACAGGGTTTCTAG -3'

Sequencing Primer
(F):5'- CTGCCTGGTCTCCAATAACC -3'
(R):5'- ACAGGGTTTCTAGTCCTTTTCAG -3'
Posted On2016-10-06