Incidental Mutation 'R5470:Heatr5b'
ID433501
Institutional Source Beutler Lab
Gene Symbol Heatr5b
Ensembl Gene ENSMUSG00000039414
Gene NameHEAT repeat containing 5B
Synonyms2010013B10Rik, A230048G03Rik, D330050P16Rik
MMRRC Submission 043031-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R5470 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location78752906-78835381 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 78821579 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000094882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097281]
Predicted Effect probably null
Transcript: ENSMUST00000097281
SMART Domains Protein: ENSMUSP00000094882
Gene: ENSMUSG00000039414

DomainStartEndE-ValueType
SCOP:d1qbkb_ 46 491 4e-6 SMART
SCOP:d1qbkb_ 846 1338 2e-16 SMART
low complexity region 1641 1650 N/A INTRINSIC
low complexity region 2039 2057 N/A INTRINSIC
Meta Mutation Damage Score 0.6208 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency 99% (79/80)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,168,941 I813F probably damaging Het
Aqr G A 2: 114,157,575 L169F probably damaging Het
Atp6v1d G A 12: 78,845,284 R182C probably benign Het
Bcl2l13 G T 6: 120,862,872 A44S probably benign Het
Brip1 T C 11: 86,148,542 K389E possibly damaging Het
C530025M09Rik G A 2: 149,831,125 probably benign Het
Ccdc7b T A 8: 129,072,600 S53T possibly damaging Het
Chd8 A G 14: 52,212,609 F154L probably damaging Het
Cop1 A T 1: 159,266,860 probably benign Het
Cyp2c39 A G 19: 39,513,530 K121R possibly damaging Het
Cyp3a57 A G 5: 145,372,619 M256V probably benign Het
Deup1 T C 9: 15,582,620 probably null Het
Dnah10 A G 5: 124,753,168 N709D probably benign Het
Dthd1 A G 5: 62,818,766 Y261C probably damaging Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
En2 C T 5: 28,166,924 T133M probably benign Het
Endou A G 15: 97,718,955 F229S probably damaging Het
Etl4 A T 2: 20,529,980 H79L probably damaging Het
Fah C T 7: 84,593,185 probably null Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fignl1 T A 11: 11,802,640 E138D probably benign Het
Fndc3a A G 14: 72,574,568 L311P possibly damaging Het
Gdf9 T A 11: 53,436,754 V179E probably benign Het
Gm14129 G T 2: 148,927,817 noncoding transcript Het
Gorab A G 1: 163,392,509 I188T probably damaging Het
Gpr152 G A 19: 4,143,129 C223Y probably damaging Het
Hsd17b3 G T 13: 64,073,899 T104N probably damaging Het
Il6ra C T 3: 89,885,995 V283M probably benign Het
Klk1b16 A T 7: 44,137,331 I5F probably damaging Het
Krt74 G A 15: 101,754,465 noncoding transcript Het
Lrch3 T A 16: 32,998,590 N650K probably damaging Het
Ly96 A T 1: 16,709,486 E126D probably benign Het
Mgarp C A 3: 51,391,285 R66L possibly damaging Het
Naalad2 T A 9: 18,330,851 T586S probably damaging Het
Ndufaf3 T C 9: 108,566,444 probably benign Het
Neb A G 2: 52,249,438 M3055T possibly damaging Het
Neo1 G T 9: 58,931,067 A478D probably damaging Het
Nmrk1 A T 19: 18,639,884 probably null Het
Nsl1 T C 1: 191,080,540 M184T probably benign Het
Nup133 T C 8: 123,930,966 N410S probably benign Het
Olfr23 T C 11: 73,940,870 I208T probably benign Het
Olfr399 A G 11: 74,053,907 I284T possibly damaging Het
Olfr610 T G 7: 103,506,509 I146L probably benign Het
Opalin A G 19: 41,066,531 S75P probably benign Het
Palb2 C A 7: 122,114,351 C903F probably damaging Het
Pcm1 T A 8: 41,287,683 W989R probably damaging Het
Pfkfb4 T A 9: 109,027,593 I389N probably damaging Het
Pitrm1 T C 13: 6,553,270 C119R probably benign Het
Plekha1 T C 7: 130,908,376 V45A probably damaging Het
Pold2 G A 11: 5,873,048 P376S probably damaging Het
Rcan2 A G 17: 43,836,283 D4G probably benign Het
Slc12a1 A T 2: 125,170,714 T299S probably damaging Het
Slc22a29 A T 19: 8,161,516 H527Q probably benign Het
Slc22a8 G A 19: 8,607,870 R261H probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slco4a1 T C 2: 180,474,114 F681S probably benign Het
Sorcs2 A T 5: 36,031,183 H860Q probably benign Het
Strn A T 17: 78,656,945 H530Q probably benign Het
Tex14 A G 11: 87,551,604 R179G probably damaging Het
Tjp3 T C 10: 81,279,547 D350G probably benign Het
Tnrc6b G T 15: 80,916,711 R1406L possibly damaging Het
Tnxb A G 17: 34,716,973 D2666G probably null Het
Ttn A T 2: 76,729,864 Y27652N probably benign Het
Utp20 T A 10: 88,817,896 E287D probably benign Het
Vmn1r45 T C 6: 89,933,716 I91V probably benign Het
Wdr72 A T 9: 74,139,699 K76* probably null Het
Zfp689 C T 7: 127,444,253 A402T probably damaging Het
Zfpm1 A G 8: 122,333,793 E207G probably damaging Het
Zhx2 G T 15: 57,823,074 R613L possibly damaging Het
Other mutations in Heatr5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Heatr5b APN 17 78803434 missense probably damaging 1.00
IGL00418:Heatr5b APN 17 78753141 missense probably damaging 1.00
IGL00786:Heatr5b APN 17 78824634 missense possibly damaging 0.95
IGL00840:Heatr5b APN 17 78765437 missense probably damaging 1.00
IGL01362:Heatr5b APN 17 78816338 splice site probably benign
IGL01419:Heatr5b APN 17 78796510 missense probably benign 0.19
IGL01447:Heatr5b APN 17 78829597 missense probably benign 0.00
IGL01591:Heatr5b APN 17 78808472 missense probably benign 0.01
IGL01743:Heatr5b APN 17 78824640 nonsense probably null
IGL01860:Heatr5b APN 17 78808480 missense probably damaging 0.98
IGL01862:Heatr5b APN 17 78796485 missense possibly damaging 0.96
IGL01984:Heatr5b APN 17 78796497 missense possibly damaging 0.63
IGL02045:Heatr5b APN 17 78808426 missense probably damaging 1.00
IGL02097:Heatr5b APN 17 78817514 missense probably damaging 1.00
IGL02168:Heatr5b APN 17 78831591 unclassified probably benign
IGL02399:Heatr5b APN 17 78827967 missense probably damaging 0.99
IGL02540:Heatr5b APN 17 78773572 missense probably damaging 1.00
IGL02719:Heatr5b APN 17 78815540 missense probably damaging 1.00
IGL02824:Heatr5b APN 17 78773680 missense probably damaging 1.00
IGL02965:Heatr5b APN 17 78753073 missense probably benign 0.37
IGL03032:Heatr5b APN 17 78760499 missense probably benign 0.45
IGL03243:Heatr5b APN 17 78763080 splice site probably benign
IGL03259:Heatr5b APN 17 78791556 missense probably damaging 1.00
IGL03349:Heatr5b APN 17 78755320 missense probably benign 0.01
R0124:Heatr5b UTSW 17 78826217 splice site probably benign
R0285:Heatr5b UTSW 17 78808453 missense probably benign 0.05
R0335:Heatr5b UTSW 17 78827946 missense probably benign 0.15
R0412:Heatr5b UTSW 17 78820854 missense probably benign 0.04
R0601:Heatr5b UTSW 17 78768545 missense probably benign
R0725:Heatr5b UTSW 17 78796396 missense probably benign 0.03
R1178:Heatr5b UTSW 17 78813269 missense probably damaging 1.00
R1444:Heatr5b UTSW 17 78753193 missense probably benign 0.17
R1444:Heatr5b UTSW 17 78755427 splice site probably benign
R1453:Heatr5b UTSW 17 78817563 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1506:Heatr5b UTSW 17 78753147 missense probably damaging 1.00
R1819:Heatr5b UTSW 17 78791511 missense probably damaging 0.98
R1835:Heatr5b UTSW 17 78773563 missense probably damaging 1.00
R1837:Heatr5b UTSW 17 78820751 missense possibly damaging 0.54
R1934:Heatr5b UTSW 17 78795918 missense possibly damaging 0.93
R2014:Heatr5b UTSW 17 78814184 missense probably damaging 1.00
R2037:Heatr5b UTSW 17 78829505 nonsense probably null
R2154:Heatr5b UTSW 17 78831444 missense probably benign 0.00
R2190:Heatr5b UTSW 17 78801756 missense probably damaging 1.00
R2191:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R2413:Heatr5b UTSW 17 78756861 critical splice donor site probably null
R3424:Heatr5b UTSW 17 78768404 missense possibly damaging 0.58
R3607:Heatr5b UTSW 17 78834217 missense probably damaging 1.00
R3759:Heatr5b UTSW 17 78824540 missense possibly damaging 0.94
R3761:Heatr5b UTSW 17 78829642 missense probably damaging 1.00
R4127:Heatr5b UTSW 17 78753174 missense possibly damaging 0.48
R4242:Heatr5b UTSW 17 78756922 missense probably benign 0.00
R4345:Heatr5b UTSW 17 78760511 missense possibly damaging 0.94
R4534:Heatr5b UTSW 17 78810596 missense possibly damaging 0.91
R4623:Heatr5b UTSW 17 78795119 missense possibly damaging 0.52
R4654:Heatr5b UTSW 17 78820701 missense possibly damaging 0.95
R4939:Heatr5b UTSW 17 78762260 missense probably benign 0.18
R4960:Heatr5b UTSW 17 78831584 missense probably benign 0.01
R5037:Heatr5b UTSW 17 78824510 missense probably benign 0.00
R5051:Heatr5b UTSW 17 78795274 missense probably damaging 1.00
R5153:Heatr5b UTSW 17 78795107 nonsense probably null
R5328:Heatr5b UTSW 17 78826362 missense possibly damaging 0.94
R5346:Heatr5b UTSW 17 78827986 missense probably benign 0.44
R5426:Heatr5b UTSW 17 78773713 missense probably damaging 1.00
R5472:Heatr5b UTSW 17 78801660 missense probably damaging 1.00
R5553:Heatr5b UTSW 17 78753351 splice site probably null
R5706:Heatr5b UTSW 17 78766875 splice site probably null
R5804:Heatr5b UTSW 17 78831522 missense probably damaging 0.97
R5978:Heatr5b UTSW 17 78806036 missense probably damaging 0.99
R6122:Heatr5b UTSW 17 78813173 missense possibly damaging 0.96
R6153:Heatr5b UTSW 17 78831441 missense possibly damaging 0.56
R6220:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R6221:Heatr5b UTSW 17 78766954 missense probably benign 0.05
R6255:Heatr5b UTSW 17 78803434 missense probably damaging 1.00
R6291:Heatr5b UTSW 17 78762097 missense probably benign 0.08
R6455:Heatr5b UTSW 17 78753073 missense probably benign 0.37
R6524:Heatr5b UTSW 17 78814106 missense possibly damaging 0.94
R6575:Heatr5b UTSW 17 78762989 missense probably damaging 1.00
R6899:Heatr5b UTSW 17 78803509 missense probably benign 0.03
R7084:Heatr5b UTSW 17 78810563 missense possibly damaging 0.68
R7138:Heatr5b UTSW 17 78827988 missense probably damaging 1.00
R7148:Heatr5b UTSW 17 78831434 missense probably damaging 0.99
R7382:Heatr5b UTSW 17 78803507 missense possibly damaging 0.64
R7420:Heatr5b UTSW 17 78808480 missense probably damaging 1.00
R7436:Heatr5b UTSW 17 78768533 missense probably benign
R7519:Heatr5b UTSW 17 78755217 missense probably benign
X0022:Heatr5b UTSW 17 78760545 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GTACCTATGGACGCTTCCTG -3'
(R):5'- TCTGTTCAACAGCGTTTTAATGTCC -3'

Sequencing Primer
(F):5'- CCTATGGACGCTTCCTGAATAAGAG -3'
(R):5'- CGAAGCTTCATGACCTGAGTTCAG -3'
Posted On2016-10-06