Incidental Mutation 'R5528:Eif2ak4'
ID433510
Institutional Source Beutler Lab
Gene Symbol Eif2ak4
Ensembl Gene ENSMUSG00000005102
Gene Nameeukaryotic translation initiation factor 2 alpha kinase 4
SynonymsGCN2
MMRRC Submission 043086-MU
Accession Numbers

MGI: 1353427

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5528 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location118388618-118475234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118427938 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 512 (E512K)
Ref Sequence ENSEMBL: ENSMUSP00000106498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005233] [ENSMUST00000102527] [ENSMUST00000110870] [ENSMUST00000110872] [ENSMUST00000110874] [ENSMUST00000110877]
Predicted Effect probably damaging
Transcript: ENSMUST00000005233
AA Change: E590K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005233
Gene: ENSMUSG00000005102
AA Change: E590K

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
RWD 25 137 3.42e-38 SMART
coiled coil region 146 205 N/A INTRINSIC
Pfam:Pkinase 323 538 4.6e-27 PFAM
Pfam:Pkinase_Tyr 326 535 5.5e-18 PFAM
Pfam:Pkinase 589 663 1.7e-11 PFAM
Pfam:Pkinase_Tyr 589 663 1.2e-5 PFAM
low complexity region 728 738 N/A INTRINSIC
Pfam:Pkinase 781 1000 2.6e-38 PFAM
Pfam:Pkinase_Tyr 786 998 1.8e-18 PFAM
Pfam:tRNA-synt_His 1054 1380 5.7e-18 PFAM
Pfam:HGTP_anticodon2 1392 1647 5.8e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102527
AA Change: E478K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099586
Gene: ENSMUSG00000005102
AA Change: E478K

DomainStartEndE-ValueType
coiled coil region 34 93 N/A INTRINSIC
Pfam:Pkinase 211 426 1.6e-22 PFAM
Pfam:Pkinase_Tyr 215 423 6.8e-18 PFAM
Pfam:Pkinase_Tyr 477 551 1.2e-5 PFAM
Pfam:Pkinase 477 552 3.9e-11 PFAM
low complexity region 616 626 N/A INTRINSIC
Pfam:Pkinase 647 888 9.4e-42 PFAM
Pfam:Pkinase_Tyr 672 886 1.4e-19 PFAM
Pfam:tRNA-synt_His 941 1268 4.8e-19 PFAM
Pfam:HGTP_anticodon2 1280 1535 1e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110870
AA Change: E312K

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106494
Gene: ENSMUSG00000005102
AA Change: E312K

DomainStartEndE-ValueType
Pfam:Pkinase 45 260 3.3e-22 PFAM
Pfam:Pkinase_Tyr 47 257 1.3e-17 PFAM
Pfam:Pkinase_Tyr 311 385 2.5e-5 PFAM
Pfam:Pkinase 311 386 8e-11 PFAM
low complexity region 450 460 N/A INTRINSIC
Pfam:Pkinase 481 722 1.9e-41 PFAM
Pfam:Pkinase_Tyr 506 720 2.8e-19 PFAM
Pfam:tRNA-synt_His 775 1102 8.7e-19 PFAM
Pfam:HGTP_anticodon2 1114 1369 1.9e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110872
AA Change: E469K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106496
Gene: ENSMUSG00000005102
AA Change: E469K

DomainStartEndE-ValueType
coiled coil region 25 84 N/A INTRINSIC
Pfam:Pkinase 202 417 3.8e-22 PFAM
Pfam:Pkinase_Tyr 206 414 1.6e-17 PFAM
Pfam:Pkinase_Tyr 468 542 2.8e-5 PFAM
Pfam:Pkinase 468 543 9.1e-11 PFAM
low complexity region 607 617 N/A INTRINSIC
Pfam:Pkinase 638 879 2.2e-41 PFAM
Pfam:Pkinase_Tyr 663 877 3.3e-19 PFAM
Pfam:tRNA-synt_His 932 1259 1.1e-18 PFAM
Pfam:HGTP_anticodon2 1271 1526 2.2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110874
AA Change: E512K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106498
Gene: ENSMUSG00000005102
AA Change: E512K

DomainStartEndE-ValueType
Pfam:RWD 8 56 6.4e-8 PFAM
coiled coil region 68 127 N/A INTRINSIC
Pfam:Pkinase 245 460 1.1e-22 PFAM
Pfam:Pkinase_Tyr 247 457 4.2e-18 PFAM
Pfam:Pkinase_Tyr 511 585 7.8e-6 PFAM
Pfam:Pkinase 511 586 2.5e-11 PFAM
low complexity region 650 660 N/A INTRINSIC
Pfam:Pkinase 681 922 6.2e-42 PFAM
Pfam:Pkinase_Tyr 706 920 9.3e-20 PFAM
Pfam:tRNA-synt_His 975 1302 3.8e-19 PFAM
Pfam:HGTP_anticodon2 1314 1569 5.4e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110877
AA Change: E590K

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106501
Gene: ENSMUSG00000005102
AA Change: E590K

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
RWD 25 137 3.42e-38 SMART
coiled coil region 146 205 N/A INTRINSIC
Pfam:Pkinase 323 538 2.6e-23 PFAM
Pfam:Pkinase_Tyr 327 535 1.1e-18 PFAM
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of kinases that phosphorylate the alpha subunit of eukaryotic translation initiation factor-2 (EIF2), resulting in the downregulaton of protein synthesis. The encoded protein responds to amino acid deprivation by binding uncharged transfer RNAs. It may also be activated by glucose deprivation and viral infection. Mutations in this gene have been found in individuals suffering from autosomal recessive pulmonary venoocclusive-disease-2. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for a null allele have altered feeding behavior, synaptic plasticity and dendritic cell function. Homozygotes for another null allele show enhanced muscle loss and morbidity after amino acid deprivation. Homozygotes for an ENU-induced allele show higher susceptibility to viral infection. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(3) Gene trapped(4) Chemically induced(1)
 

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,066,499 L483P probably benign Het
1700025F22Rik T C 19: 11,141,635 S37G possibly damaging Het
3110043O21Rik T C 4: 35,213,556 D198G probably benign Het
4930519G04Rik T G 5: 114,874,354 probably null Het
Ablim2 C T 5: 35,856,166 Q148* probably null Het
Ap3s2 A T 7: 79,880,486 *194R probably null Het
Arpp21 C T 9: 112,149,353 A235T probably benign Het
Ccdc33 T C 9: 58,028,795 D939G probably benign Het
Celsr2 A T 3: 108,413,294 I734N probably damaging Het
Clcn1 C A 6: 42,300,341 N455K probably benign Het
Cpne8 C T 15: 90,619,690 V91I possibly damaging Het
Ddx1 A G 12: 13,229,294 V448A probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Eif2a G T 3: 58,548,512 D311Y probably damaging Het
Esp15 A T 17: 39,644,749 Y69F probably benign Het
Fam102a G A 2: 32,566,327 A334T probably damaging Het
Gm5689 A G 18: 42,173,662 probably null Het
Gucy1a1 A T 3: 82,109,073 Y203N probably damaging Het
Hook3 T C 8: 26,072,293 Q248R probably damaging Het
Ifit2 T A 19: 34,573,537 V159E possibly damaging Het
Il17rd T C 14: 27,088,067 V20A possibly damaging Het
Kcnq3 T A 15: 66,025,178 D291V probably damaging Het
Klf11 A T 12: 24,654,930 M111L probably benign Het
Lama5 T A 2: 180,194,563 H1165L probably benign Het
Lmo7 A G 14: 101,902,086 N702S probably damaging Het
Lta4h T C 10: 93,471,874 V323A probably damaging Het
Mkrn3 T C 7: 62,418,987 E352G possibly damaging Het
Mtf2 T A 5: 108,094,157 L277Q probably damaging Het
Myo9b A G 8: 71,323,274 N370D probably benign Het
Nlrp4e A C 7: 23,336,891 K723T probably benign Het
Nsun3 A G 16: 62,735,326 V279A possibly damaging Het
Pde6b A G 5: 108,423,558 D459G probably benign Het
Phgdh T C 3: 98,328,339 I121V probably benign Het
Pik3r5 T C 11: 68,495,977 C811R probably damaging Het
Spaca6 A C 17: 17,831,082 I27L probably benign Het
Trmt1l G A 1: 151,454,995 V588I probably benign Het
Tshr A G 12: 91,537,193 N302D probably damaging Het
Vmn2r23 A G 6: 123,713,002 D279G probably damaging Het
Wnt3a T C 11: 59,275,280 N58S probably damaging Het
Zkscan8 A G 13: 21,520,725 V276A probably damaging Het
Other mutations in Eif2ak4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Eif2ak4 APN 2 118464055 missense probably damaging 1.00
IGL00806:Eif2ak4 APN 2 118441166 missense probably benign 0.08
IGL01343:Eif2ak4 APN 2 118422089 missense probably benign 0.00
IGL01796:Eif2ak4 APN 2 118446304 missense probably benign 0.10
IGL02263:Eif2ak4 APN 2 118461778 missense probably benign 0.00
IGL02391:Eif2ak4 APN 2 118420791 missense probably benign 0.19
IGL02516:Eif2ak4 APN 2 118436254 missense probably damaging 1.00
IGL02603:Eif2ak4 APN 2 118450326 missense probably damaging 1.00
IGL02731:Eif2ak4 APN 2 118388814 missense probably benign
IGL02928:Eif2ak4 APN 2 118472687 critical splice donor site probably null
IGL02947:Eif2ak4 APN 2 118431033 missense probably benign 0.00
IGL03191:Eif2ak4 APN 2 118422212 missense probably damaging 1.00
IGL03202:Eif2ak4 APN 2 118400620 missense probably damaging 1.00
IGL03235:Eif2ak4 APN 2 118443140 missense probably damaging 1.00
IGL03375:Eif2ak4 APN 2 118422318 missense probably benign 0.08
absurdum UTSW 2 118420810 nonsense probably null
Ad UTSW 2 118436241 missense probably damaging 1.00
atchoum UTSW 2 118400653 splice site probably benign
reductio UTSW 2 118436158 splice site probably null
PIT4520001:Eif2ak4 UTSW 2 118462327 missense probably damaging 1.00
R0023:Eif2ak4 UTSW 2 118462721 missense probably damaging 1.00
R0358:Eif2ak4 UTSW 2 118463929 intron probably null
R0482:Eif2ak4 UTSW 2 118462347 missense probably damaging 1.00
R0505:Eif2ak4 UTSW 2 118431036 missense probably benign 0.01
R0523:Eif2ak4 UTSW 2 118442096 critical splice donor site probably null
R0578:Eif2ak4 UTSW 2 118474991 splice site probably benign
R0615:Eif2ak4 UTSW 2 118436185 missense probably damaging 1.00
R1300:Eif2ak4 UTSW 2 118463983 missense possibly damaging 0.79
R1531:Eif2ak4 UTSW 2 118443210 missense probably damaging 1.00
R1777:Eif2ak4 UTSW 2 118430839 missense probably damaging 0.98
R1866:Eif2ak4 UTSW 2 118472661 missense probably damaging 1.00
R1932:Eif2ak4 UTSW 2 118448486 missense probably damaging 1.00
R1977:Eif2ak4 UTSW 2 118461757 nonsense probably null
R2011:Eif2ak4 UTSW 2 118430947 missense probably damaging 1.00
R2046:Eif2ak4 UTSW 2 118451408 splice site probably benign
R2122:Eif2ak4 UTSW 2 118455793 missense probably damaging 1.00
R2125:Eif2ak4 UTSW 2 118422123 missense probably benign 0.02
R2126:Eif2ak4 UTSW 2 118422123 missense probably benign 0.02
R2193:Eif2ak4 UTSW 2 118422266 missense probably benign 0.12
R2259:Eif2ak4 UTSW 2 118455783 missense probably damaging 0.97
R2513:Eif2ak4 UTSW 2 118426583 missense probably damaging 1.00
R3798:Eif2ak4 UTSW 2 118474083 missense probably damaging 1.00
R3898:Eif2ak4 UTSW 2 118430923 missense probably damaging 1.00
R3900:Eif2ak4 UTSW 2 118475029 missense probably damaging 1.00
R4375:Eif2ak4 UTSW 2 118427924 missense probably damaging 1.00
R4423:Eif2ak4 UTSW 2 118439066 missense probably benign 0.01
R4589:Eif2ak4 UTSW 2 118417338 missense probably damaging 1.00
R4734:Eif2ak4 UTSW 2 118422087 missense probably damaging 1.00
R5173:Eif2ak4 UTSW 2 118408360 missense probably damaging 1.00
R5367:Eif2ak4 UTSW 2 118436158 splice site probably null
R5471:Eif2ak4 UTSW 2 118474132 missense probably benign 0.02
R5634:Eif2ak4 UTSW 2 118462311 missense probably damaging 1.00
R5726:Eif2ak4 UTSW 2 118443132 missense probably damaging 1.00
R5756:Eif2ak4 UTSW 2 118462740 missense possibly damaging 0.95
R5779:Eif2ak4 UTSW 2 118412963 missense possibly damaging 0.85
R5807:Eif2ak4 UTSW 2 118388851 missense probably benign
R6045:Eif2ak4 UTSW 2 118388815 nonsense probably null
R6187:Eif2ak4 UTSW 2 118457157 missense probably damaging 0.98
R6193:Eif2ak4 UTSW 2 118400600 start gained probably benign
R6468:Eif2ak4 UTSW 2 118436241 missense probably damaging 1.00
R6555:Eif2ak4 UTSW 2 118427869 missense probably damaging 0.96
R6616:Eif2ak4 UTSW 2 118454845 nonsense probably null
R6737:Eif2ak4 UTSW 2 118462268 frame shift probably null
R6956:Eif2ak4 UTSW 2 118422267 missense probably damaging 0.96
R7075:Eif2ak4 UTSW 2 118420810 nonsense probably null
R7109:Eif2ak4 UTSW 2 118405051 missense probably damaging 1.00
R7228:Eif2ak4 UTSW 2 118457157 missense probably damaging 0.98
R7441:Eif2ak4 UTSW 2 118471896 missense probably benign 0.01
R7555:Eif2ak4 UTSW 2 118417283 missense possibly damaging 0.64
R7567:Eif2ak4 UTSW 2 118450314 missense probably benign
X0061:Eif2ak4 UTSW 2 118468176 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCATACTTAGGTTGTTGGCTCCTG -3'
(R):5'- AAGTGCTCCCAGCTTCGAAG -3'

Sequencing Primer
(F):5'- TCCAGAAGAGGCCATTAGGTTCC -3'
(R):5'- ATGGAAACCAAGCCTGTG -3'
Posted On2016-10-06