Incidental Mutation 'R5528:Eif2a'
ID433513
Institutional Source Beutler Lab
Gene Symbol Eif2a
Ensembl Gene ENSMUSG00000027810
Gene Nameeukaryotic translation initiation factor 2A
SynonymsD3Ertd194e
MMRRC Submission 043086-MU
Accession Numbers

Genbank: NM_001005509.2; Ensembl: ENSMUST00000029387

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5528 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location58525821-58557501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 58548512 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 311 (D311Y)
Ref Sequence ENSEMBL: ENSMUSP00000029387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029387] [ENSMUST00000135876] [ENSMUST00000138848] [ENSMUST00000154219]
Predicted Effect probably damaging
Transcript: ENSMUST00000029387
AA Change: D311Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029387
Gene: ENSMUSG00000027810
AA Change: D311Y

DomainStartEndE-ValueType
low complexity region 145 159 N/A INTRINSIC
Pfam:eIF2A 216 411 1e-77 PFAM
low complexity region 488 502 N/A INTRINSIC
coiled coil region 528 575 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138827
Predicted Effect probably benign
Transcript: ENSMUST00000138848
SMART Domains Protein: ENSMUSP00000120901
Gene: ENSMUSG00000027810

DomainStartEndE-ValueType
SCOP:d1kb0a2 27 160 5e-9 SMART
Pfam:eIF2A 199 251 1.5e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148251
Predicted Effect probably benign
Transcript: ENSMUST00000154219
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a eukaryotic translation initiation factor that catalyzes the formation of puromycin-sensitive 80 S preinitiation complexes and the poly(U)-directed synthesis of polyphenylalanine at low concentrations of Mg2+. This gene should not be confused with eIF2-alpha (EIF2S1, Gene ID: 1965), the alpha subunit of the eIF2 translation initiation complex. Although both of these proteins function in binding initiator tRNA to the 40 S ribosomal subunit, the encoded protein does so in a codon-dependent manner, whereas eIF2 complex requires GTP. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele are viable and fertile with no visible phenotypes. [provided by MGI curators]
Allele List at MGI

All alleles(51) : Targeted, other(2) Gene trapped(49)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,066,499 L483P probably benign Het
1700025F22Rik T C 19: 11,141,635 S37G possibly damaging Het
3110043O21Rik T C 4: 35,213,556 D198G probably benign Het
4930519G04Rik T G 5: 114,874,354 probably null Het
Ablim2 C T 5: 35,856,166 Q148* probably null Het
Ap3s2 A T 7: 79,880,486 *194R probably null Het
Arpp21 C T 9: 112,149,353 A235T probably benign Het
Ccdc33 T C 9: 58,028,795 D939G probably benign Het
Celsr2 A T 3: 108,413,294 I734N probably damaging Het
Clcn1 C A 6: 42,300,341 N455K probably benign Het
Cpne8 C T 15: 90,619,690 V91I possibly damaging Het
Ddx1 A G 12: 13,229,294 V448A probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Eif2ak4 G A 2: 118,427,938 E512K probably damaging Het
Esp15 A T 17: 39,644,749 Y69F probably benign Het
Fam102a G A 2: 32,566,327 A334T probably damaging Het
Gm5689 A G 18: 42,173,662 probably null Het
Gucy1a1 A T 3: 82,109,073 Y203N probably damaging Het
Hook3 T C 8: 26,072,293 Q248R probably damaging Het
Ifit2 T A 19: 34,573,537 V159E possibly damaging Het
Il17rd T C 14: 27,088,067 V20A possibly damaging Het
Kcnq3 T A 15: 66,025,178 D291V probably damaging Het
Klf11 A T 12: 24,654,930 M111L probably benign Het
Lama5 T A 2: 180,194,563 H1165L probably benign Het
Lmo7 A G 14: 101,902,086 N702S probably damaging Het
Lta4h T C 10: 93,471,874 V323A probably damaging Het
Mkrn3 T C 7: 62,418,987 E352G possibly damaging Het
Mtf2 T A 5: 108,094,157 L277Q probably damaging Het
Myo9b A G 8: 71,323,274 N370D probably benign Het
Nlrp4e A C 7: 23,336,891 K723T probably benign Het
Nsun3 A G 16: 62,735,326 V279A possibly damaging Het
Pde6b A G 5: 108,423,558 D459G probably benign Het
Phgdh T C 3: 98,328,339 I121V probably benign Het
Pik3r5 T C 11: 68,495,977 C811R probably damaging Het
Spaca6 A C 17: 17,831,082 I27L probably benign Het
Trmt1l G A 1: 151,454,995 V588I probably benign Het
Tshr A G 12: 91,537,193 N302D probably damaging Het
Vmn2r23 A G 6: 123,713,002 D279G probably damaging Het
Wnt3a T C 11: 59,275,280 N58S probably damaging Het
Zkscan8 A G 13: 21,520,725 V276A probably damaging Het
Other mutations in Eif2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02323:Eif2a APN 3 58548603 missense possibly damaging 0.89
IGL02823:Eif2a APN 3 58548671 missense probably benign 0.01
IGL03086:Eif2a APN 3 58541117 missense probably benign 0.00
IGL03165:Eif2a APN 3 58548628 nonsense probably null
1mM(1):Eif2a UTSW 3 58545303 missense possibly damaging 0.75
PIT4576001:Eif2a UTSW 3 58545553 missense probably damaging 1.00
R0540:Eif2a UTSW 3 58555652 critical splice donor site probably null
R0607:Eif2a UTSW 3 58555652 critical splice donor site probably null
R1061:Eif2a UTSW 3 58545065 nonsense probably null
R1499:Eif2a UTSW 3 58537584 nonsense probably null
R1922:Eif2a UTSW 3 58548530 missense probably damaging 1.00
R3980:Eif2a UTSW 3 58539539 missense probably benign 0.00
R4017:Eif2a UTSW 3 58545355 missense probably damaging 1.00
R4080:Eif2a UTSW 3 58539629 missense possibly damaging 0.52
R6320:Eif2a UTSW 3 58557096 splice site probably null
R7081:Eif2a UTSW 3 58541718 critical splice donor site probably null
R7414:Eif2a UTSW 3 58526081 nonsense probably null
R7447:Eif2a UTSW 3 58545542 missense probably damaging 0.97
R7497:Eif2a UTSW 3 58548681 missense probably damaging 1.00
R7701:Eif2a UTSW 3 58552570 missense possibly damaging 0.72
R8205:Eif2a UTSW 3 58548735 missense probably damaging 1.00
Z1176:Eif2a UTSW 3 58548884 missense probably benign
Z1177:Eif2a UTSW 3 58531120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGAACTCATGCCACTAGAGC -3'
(R):5'- AGCACATGTGGCTGTTAAGATATG -3'

Sequencing Primer
(F):5'- TCATGCCACTAGAGCCTGCTG -3'
(R):5'- AAGATATGCTCACCATCTGGG -3'
Posted On2016-10-06