Incidental Mutation 'R5528:Eif2a'
ID 433513
Institutional Source Beutler Lab
Gene Symbol Eif2a
Ensembl Gene ENSMUSG00000027810
Gene Name eukaryotic translation initiation factor 2A
Synonyms D3Ertd194e
MMRRC Submission 043086-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5528 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 58433252-58464922 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 58455933 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 311 (D311Y)
Ref Sequence ENSEMBL: ENSMUSP00000029387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029387] [ENSMUST00000135876] [ENSMUST00000138848] [ENSMUST00000154219]
AlphaFold Q8BJW6
Predicted Effect probably damaging
Transcript: ENSMUST00000029387
AA Change: D311Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029387
Gene: ENSMUSG00000027810
AA Change: D311Y

DomainStartEndE-ValueType
low complexity region 145 159 N/A INTRINSIC
Pfam:eIF2A 216 411 1e-77 PFAM
low complexity region 488 502 N/A INTRINSIC
coiled coil region 528 575 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138827
Predicted Effect probably benign
Transcript: ENSMUST00000138848
SMART Domains Protein: ENSMUSP00000120901
Gene: ENSMUSG00000027810

DomainStartEndE-ValueType
SCOP:d1kb0a2 27 160 5e-9 SMART
Pfam:eIF2A 199 251 1.5e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148251
Predicted Effect probably benign
Transcript: ENSMUST00000154219
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a eukaryotic translation initiation factor that catalyzes the formation of puromycin-sensitive 80 S preinitiation complexes and the poly(U)-directed synthesis of polyphenylalanine at low concentrations of Mg2+. This gene should not be confused with eIF2-alpha (EIF2S1, Gene ID: 1965), the alpha subunit of the eIF2 translation initiation complex. Although both of these proteins function in binding initiator tRNA to the 40 S ribosomal subunit, the encoded protein does so in a codon-dependent manner, whereas eIF2 complex requires GTP. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele are viable and fertile with no visible phenotypes. [provided by MGI curators]
Allele List at MGI

All alleles(51) : Targeted, other(2) Gene trapped(49)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 137,772,260 (GRCm39) L483P probably benign Het
4930519G04Rik T G 5: 115,012,415 (GRCm39) probably null Het
Ablim2 C T 5: 36,013,510 (GRCm39) Q148* probably null Het
Ap3s2 A T 7: 79,530,234 (GRCm39) *194R probably null Het
Arpp21 C T 9: 111,978,421 (GRCm39) A235T probably benign Het
C9orf72 T C 4: 35,213,556 (GRCm39) D198G probably benign Het
Ccdc33 T C 9: 57,936,078 (GRCm39) D939G probably benign Het
Celsr2 A T 3: 108,320,610 (GRCm39) I734N probably damaging Het
Clcn1 C A 6: 42,277,275 (GRCm39) N455K probably benign Het
Cpne8 C T 15: 90,503,893 (GRCm39) V91I possibly damaging Het
Cstdc7 A G 18: 42,306,727 (GRCm39) probably null Het
Ddx1 A G 12: 13,279,295 (GRCm39) V448A probably damaging Het
Dnhd1 G A 7: 105,352,416 (GRCm39) R2523Q probably damaging Het
Eeig1 G A 2: 32,456,339 (GRCm39) A334T probably damaging Het
Eif2ak4 G A 2: 118,258,419 (GRCm39) E512K probably damaging Het
Esp15 A T 17: 39,955,640 (GRCm39) Y69F probably benign Het
Gucy1a1 A T 3: 82,016,380 (GRCm39) Y203N probably damaging Het
Hook3 T C 8: 26,562,321 (GRCm39) Q248R probably damaging Het
Ifit2 T A 19: 34,550,937 (GRCm39) V159E possibly damaging Het
Il17rd T C 14: 26,810,024 (GRCm39) V20A possibly damaging Het
Kcnq3 T A 15: 65,897,027 (GRCm39) D291V probably damaging Het
Klf11 A T 12: 24,704,929 (GRCm39) M111L probably benign Het
Lama5 T A 2: 179,836,356 (GRCm39) H1165L probably benign Het
Lmo7 A G 14: 102,139,522 (GRCm39) N702S probably damaging Het
Lta4h T C 10: 93,307,736 (GRCm39) V323A probably damaging Het
Mkrn3 T C 7: 62,068,735 (GRCm39) E352G possibly damaging Het
Ms4a19 T C 19: 11,118,999 (GRCm39) S37G possibly damaging Het
Mtf2 T A 5: 108,242,023 (GRCm39) L277Q probably damaging Het
Myo9b A G 8: 71,775,918 (GRCm39) N370D probably benign Het
Nlrp4e A C 7: 23,036,316 (GRCm39) K723T probably benign Het
Nsun3 A G 16: 62,555,689 (GRCm39) V279A possibly damaging Het
Pde6b A G 5: 108,571,424 (GRCm39) D459G probably benign Het
Phgdh T C 3: 98,235,655 (GRCm39) I121V probably benign Het
Pik3r5 T C 11: 68,386,803 (GRCm39) C811R probably damaging Het
Spaca6 A C 17: 18,051,344 (GRCm39) I27L probably benign Het
Trmt1l G A 1: 151,330,746 (GRCm39) V588I probably benign Het
Tshr A G 12: 91,503,967 (GRCm39) N302D probably damaging Het
Vmn2r23 A G 6: 123,689,961 (GRCm39) D279G probably damaging Het
Wnt3a T C 11: 59,166,106 (GRCm39) N58S probably damaging Het
Zkscan8 A G 13: 21,704,895 (GRCm39) V276A probably damaging Het
Other mutations in Eif2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02323:Eif2a APN 3 58,456,024 (GRCm39) missense possibly damaging 0.89
IGL02823:Eif2a APN 3 58,456,092 (GRCm39) missense probably benign 0.01
IGL03086:Eif2a APN 3 58,448,538 (GRCm39) missense probably benign 0.00
IGL03165:Eif2a APN 3 58,456,049 (GRCm39) nonsense probably null
1mM(1):Eif2a UTSW 3 58,452,724 (GRCm39) missense possibly damaging 0.75
PIT4576001:Eif2a UTSW 3 58,452,974 (GRCm39) missense probably damaging 1.00
R0540:Eif2a UTSW 3 58,463,073 (GRCm39) critical splice donor site probably null
R0607:Eif2a UTSW 3 58,463,073 (GRCm39) critical splice donor site probably null
R1061:Eif2a UTSW 3 58,452,486 (GRCm39) nonsense probably null
R1499:Eif2a UTSW 3 58,445,005 (GRCm39) nonsense probably null
R1922:Eif2a UTSW 3 58,455,951 (GRCm39) missense probably damaging 1.00
R3980:Eif2a UTSW 3 58,446,960 (GRCm39) missense probably benign 0.00
R4017:Eif2a UTSW 3 58,452,776 (GRCm39) missense probably damaging 1.00
R4080:Eif2a UTSW 3 58,447,050 (GRCm39) missense possibly damaging 0.52
R6320:Eif2a UTSW 3 58,464,517 (GRCm39) splice site probably null
R7081:Eif2a UTSW 3 58,449,139 (GRCm39) critical splice donor site probably null
R7414:Eif2a UTSW 3 58,433,502 (GRCm39) nonsense probably null
R7447:Eif2a UTSW 3 58,452,963 (GRCm39) missense probably damaging 0.97
R7497:Eif2a UTSW 3 58,456,102 (GRCm39) missense probably damaging 1.00
R7701:Eif2a UTSW 3 58,459,991 (GRCm39) missense possibly damaging 0.72
R8205:Eif2a UTSW 3 58,456,156 (GRCm39) missense probably damaging 1.00
R8826:Eif2a UTSW 3 58,456,049 (GRCm39) nonsense probably null
R9103:Eif2a UTSW 3 58,452,461 (GRCm39) missense
R9165:Eif2a UTSW 3 58,452,695 (GRCm39) missense probably damaging 1.00
R9232:Eif2a UTSW 3 58,463,022 (GRCm39) missense probably benign
R9280:Eif2a UTSW 3 58,447,009 (GRCm39) intron probably benign
R9492:Eif2a UTSW 3 58,448,475 (GRCm39) missense probably benign 0.00
R9524:Eif2a UTSW 3 58,448,467 (GRCm39) missense possibly damaging 0.87
Z1176:Eif2a UTSW 3 58,456,305 (GRCm39) missense probably benign
Z1177:Eif2a UTSW 3 58,438,541 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGAACTCATGCCACTAGAGC -3'
(R):5'- AGCACATGTGGCTGTTAAGATATG -3'

Sequencing Primer
(F):5'- TCATGCCACTAGAGCCTGCTG -3'
(R):5'- AAGATATGCTCACCATCTGGG -3'
Posted On 2016-10-06