Mutagenetix > Incidental Mutation

Incidental Mutation 'R5528:Gucy1a1'

433514

Institutional Source

Beutler Lab

Gene Symbol

Gucy1a1

Ensembl Gene

ENSMUSG00000033910

Gene Name

guanylate cyclase 1, soluble, alpha 1

Synonyms

sGC-alpha1, alpha 1 sGC, 1200016O07Rik

MMRRC Submission

043086-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.173) question?

Stock #

R5528 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

82092427-82145789 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 82109073 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 203 (Y203N)

Ref Sequence

ENSEMBL: ENSMUSP00000142138 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048976] [ENSMUST00000193924]

AlphaFold

Q9ERL9

Predicted Effect

probably damaging
Transcript: ENSMUST00000048976
AA Change: Y203N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000048918
Gene: ENSMUSG00000033910
AA Change: Y203N

Domain	Start	End	E-Value	Type
Pfam:HNOB	85	235	2.5e-8	PFAM
PDB:4GJ4\|D	277	403	1e-18	PDB
CYCc	445	636	4.71e-103	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183464

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191942

Predicted Effect

probably damaging
Transcript: ENSMUST00000193924
AA Change: Y203N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142138
Gene: ENSMUSG00000033910
AA Change: Y203N

Domain	Start	End	E-Value	Type
Pfam:HNOB	73	237	1.6e-7	PFAM
PDB:4GJ4\|D	277	403	1e-18	PDB
CYCc	445	636	4.71e-103	SMART

Coding Region Coverage

1x: 98.6%
3x: 97.4%
10x: 95.4%
20x: 91.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Soluble guanylate cyclases are heterodimeric proteins that catalyze the conversion of GTP to 3',5'-cyclic GMP and pyrophosphate. The protein encoded by this gene is an alpha subunit of this complex and it interacts with a beta subunit to form the guanylate cyclase enzyme, which is activated by nitric oxide. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null mutation display mild elevation of systolic blood pressure, and abnormal blood vessel and platelet responses to NO. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	C	3: 138,066,499	L483P	probably benign	Het
1700025F22Rik	T	C	19: 11,141,635	S37G	possibly damaging	Het
3110043O21Rik	T	C	4: 35,213,556	D198G	probably benign	Het
4930519G04Rik	T	G	5: 114,874,354		probably null	Het
Ablim2	C	T	5: 35,856,166	Q148*	probably null	Het
Ap3s2	A	T	7: 79,880,486	*194R	probably null	Het
Arpp21	C	T	9: 112,149,353	A235T	probably benign	Het
Ccdc33	T	C	9: 58,028,795	D939G	probably benign	Het
Celsr2	A	T	3: 108,413,294	I734N	probably damaging	Het
Clcn1	C	A	6: 42,300,341	N455K	probably benign	Het
Cpne8	C	T	15: 90,619,690	V91I	possibly damaging	Het
Ddx1	A	G	12: 13,229,294	V448A	probably damaging	Het
Dnhd1	G	A	7: 105,703,209	R2523Q	probably damaging	Het
Eif2a	G	T	3: 58,548,512	D311Y	probably damaging	Het
Eif2ak4	G	A	2: 118,427,938	E512K	probably damaging	Het
Esp15	A	T	17: 39,644,749	Y69F	probably benign	Het
Fam102a	G	A	2: 32,566,327	A334T	probably damaging	Het
Gm5689	A	G	18: 42,173,662		probably null	Het
Hook3	T	C	8: 26,072,293	Q248R	probably damaging	Het
Ifit2	T	A	19: 34,573,537	V159E	possibly damaging	Het
Il17rd	T	C	14: 27,088,067	V20A	possibly damaging	Het
Kcnq3	T	A	15: 66,025,178	D291V	probably damaging	Het
Klf11	A	T	12: 24,654,930	M111L	probably benign	Het
Lama5	T	A	2: 180,194,563	H1165L	probably benign	Het
Lmo7	A	G	14: 101,902,086	N702S	probably damaging	Het
Lta4h	T	C	10: 93,471,874	V323A	probably damaging	Het
Mkrn3	T	C	7: 62,418,987	E352G	possibly damaging	Het
Mtf2	T	A	5: 108,094,157	L277Q	probably damaging	Het
Myo9b	A	G	8: 71,323,274	N370D	probably benign	Het
Nlrp4e	A	C	7: 23,336,891	K723T	probably benign	Het
Nsun3	A	G	16: 62,735,326	V279A	possibly damaging	Het
Pde6b	A	G	5: 108,423,558	D459G	probably benign	Het
Phgdh	T	C	3: 98,328,339	I121V	probably benign	Het
Pik3r5	T	C	11: 68,495,977	C811R	probably damaging	Het
Spaca6	A	C	17: 17,831,082	I27L	probably benign	Het
Trmt1l	G	A	1: 151,454,995	V588I	probably benign	Het
Tshr	A	G	12: 91,537,193	N302D	probably damaging	Het
Vmn2r23	A	G	6: 123,713,002	D279G	probably damaging	Het
Wnt3a	T	C	11: 59,275,280	N58S	probably damaging	Het
Zkscan8	A	G	13: 21,520,725	V276A	probably damaging	Het

Other mutations in Gucy1a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00951:Gucy1a1	APN	3	82111191	missense	probably benign	0.00
IGL01626:Gucy1a1	APN	3	82108619	missense	probably damaging	1.00
IGL01662:Gucy1a1	APN	3	82109253	missense	possibly damaging	0.63
IGL02480:Gucy1a1	APN	3	82097733	missense	probably damaging	1.00
IGL02902:Gucy1a1	APN	3	82118917	missense	possibly damaging	0.87
IGL03022:Gucy1a1	APN	3	82109097	missense	probably benign	0.30
IGL03056:Gucy1a1	APN	3	82113287	missense	probably benign	0.00
IGL03089:Gucy1a1	APN	3	82097681	missense	probably damaging	1.00
IGL03226:Gucy1a1	APN	3	82119024	missense	probably benign	0.00
IGL03377:Gucy1a1	APN	3	82106015	missense	probably damaging	1.00
R0245:Gucy1a1	UTSW	3	82108787	missense	possibly damaging	0.67
R0762:Gucy1a1	UTSW	3	82094896	missense	unknown
R0907:Gucy1a1	UTSW	3	82111191	missense	probably benign	0.00
R1242:Gucy1a1	UTSW	3	82105953	splice site	probably null
R1625:Gucy1a1	UTSW	3	82102055	missense	probably benign	0.02
R1671:Gucy1a1	UTSW	3	82106222	missense	probably damaging	1.00
R2056:Gucy1a1	UTSW	3	82109285	missense	possibly damaging	0.89
R2094:Gucy1a1	UTSW	3	82113332	missense	probably benign
R2140:Gucy1a1	UTSW	3	82118886	splice site	probably null
R2154:Gucy1a1	UTSW	3	82111151	critical splice donor site	probably null
R3418:Gucy1a1	UTSW	3	82106133	missense	probably damaging	1.00
R3419:Gucy1a1	UTSW	3	82106133	missense	probably damaging	1.00
R4290:Gucy1a1	UTSW	3	82094759	missense	possibly damaging	0.95
R4291:Gucy1a1	UTSW	3	82094759	missense	possibly damaging	0.95
R4292:Gucy1a1	UTSW	3	82094759	missense	possibly damaging	0.95
R4294:Gucy1a1	UTSW	3	82094759	missense	possibly damaging	0.95
R4573:Gucy1a1	UTSW	3	82108922	missense	possibly damaging	0.95
R4629:Gucy1a1	UTSW	3	82097624	missense	probably damaging	1.00
R4755:Gucy1a1	UTSW	3	82094795	missense	probably benign	0.40
R4865:Gucy1a1	UTSW	3	82119162	utr 5 prime	probably benign
R5933:Gucy1a1	UTSW	3	82094807	missense	probably damaging	0.96
R6278:Gucy1a1	UTSW	3	82097634	missense	probably damaging	1.00
R6385:Gucy1a1	UTSW	3	82109006	missense	probably benign
R7011:Gucy1a1	UTSW	3	82109115	missense	probably damaging	1.00
R7361:Gucy1a1	UTSW	3	82097720	missense	probably damaging	1.00
R7648:Gucy1a1	UTSW	3	82108707	missense	possibly damaging	0.63
R7709:Gucy1a1	UTSW	3	82094789	missense	unknown
R7770:Gucy1a1	UTSW	3	82108805	missense	possibly damaging	0.95
R8443:Gucy1a1	UTSW	3	82097693	missense	probably damaging	1.00
R8531:Gucy1a1	UTSW	3	82111161	missense	probably benign
R8872:Gucy1a1	UTSW	3	82108742	missense	probably damaging	0.99
R9055:Gucy1a1	UTSW	3	82109126	missense	possibly damaging	0.73
R9168:Gucy1a1	UTSW	3	82102046	missense	probably damaging	0.97
R9231:Gucy1a1	UTSW	3	82106001	missense	probably damaging	1.00
R9316:Gucy1a1	UTSW	3	82108943	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- TCACATGAACGGAGTAGAGC -3'
(R):5'- TCTGAGCTGACCCACTTGATG -3'

Sequencing Primer
(F):5'- CAAATAGGGCTGGTTCACAAACTCG -3'
(R):5'- CGAGGAGCTGTTCAAGATCTGC -3'

Posted On

2016-10-06