Incidental Mutation 'R5528:Gucy1a1'
ID433514
Institutional Source Beutler Lab
Gene Symbol Gucy1a1
Ensembl Gene ENSMUSG00000033910
Gene Nameguanylate cyclase 1, soluble, alpha 1
SynonymssGC-alpha1, alpha 1 sGC, 1200016O07Rik
MMRRC Submission 043086-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R5528 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location82092427-82145789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82109073 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 203 (Y203N)
Ref Sequence ENSEMBL: ENSMUSP00000142138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048976] [ENSMUST00000193924]
Predicted Effect probably damaging
Transcript: ENSMUST00000048976
AA Change: Y203N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048918
Gene: ENSMUSG00000033910
AA Change: Y203N

DomainStartEndE-ValueType
Pfam:HNOB 85 235 2.5e-8 PFAM
PDB:4GJ4|D 277 403 1e-18 PDB
CYCc 445 636 4.71e-103 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191942
Predicted Effect probably damaging
Transcript: ENSMUST00000193924
AA Change: Y203N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142138
Gene: ENSMUSG00000033910
AA Change: Y203N

DomainStartEndE-ValueType
Pfam:HNOB 73 237 1.6e-7 PFAM
PDB:4GJ4|D 277 403 1e-18 PDB
CYCc 445 636 4.71e-103 SMART
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Soluble guanylate cyclases are heterodimeric proteins that catalyze the conversion of GTP to 3',5'-cyclic GMP and pyrophosphate. The protein encoded by this gene is an alpha subunit of this complex and it interacts with a beta subunit to form the guanylate cyclase enzyme, which is activated by nitric oxide. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null mutation display mild elevation of systolic blood pressure, and abnormal blood vessel and platelet responses to NO. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,066,499 L483P probably benign Het
1700025F22Rik T C 19: 11,141,635 S37G possibly damaging Het
3110043O21Rik T C 4: 35,213,556 D198G probably benign Het
4930519G04Rik T G 5: 114,874,354 probably null Het
Ablim2 C T 5: 35,856,166 Q148* probably null Het
Ap3s2 A T 7: 79,880,486 *194R probably null Het
Arpp21 C T 9: 112,149,353 A235T probably benign Het
Ccdc33 T C 9: 58,028,795 D939G probably benign Het
Celsr2 A T 3: 108,413,294 I734N probably damaging Het
Clcn1 C A 6: 42,300,341 N455K probably benign Het
Cpne8 C T 15: 90,619,690 V91I possibly damaging Het
Ddx1 A G 12: 13,229,294 V448A probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Eif2a G T 3: 58,548,512 D311Y probably damaging Het
Eif2ak4 G A 2: 118,427,938 E512K probably damaging Het
Esp15 A T 17: 39,644,749 Y69F probably benign Het
Fam102a G A 2: 32,566,327 A334T probably damaging Het
Gm5689 A G 18: 42,173,662 probably null Het
Hook3 T C 8: 26,072,293 Q248R probably damaging Het
Ifit2 T A 19: 34,573,537 V159E possibly damaging Het
Il17rd T C 14: 27,088,067 V20A possibly damaging Het
Kcnq3 T A 15: 66,025,178 D291V probably damaging Het
Klf11 A T 12: 24,654,930 M111L probably benign Het
Lama5 T A 2: 180,194,563 H1165L probably benign Het
Lmo7 A G 14: 101,902,086 N702S probably damaging Het
Lta4h T C 10: 93,471,874 V323A probably damaging Het
Mkrn3 T C 7: 62,418,987 E352G possibly damaging Het
Mtf2 T A 5: 108,094,157 L277Q probably damaging Het
Myo9b A G 8: 71,323,274 N370D probably benign Het
Nlrp4e A C 7: 23,336,891 K723T probably benign Het
Nsun3 A G 16: 62,735,326 V279A possibly damaging Het
Pde6b A G 5: 108,423,558 D459G probably benign Het
Phgdh T C 3: 98,328,339 I121V probably benign Het
Pik3r5 T C 11: 68,495,977 C811R probably damaging Het
Spaca6 A C 17: 17,831,082 I27L probably benign Het
Trmt1l G A 1: 151,454,995 V588I probably benign Het
Tshr A G 12: 91,537,193 N302D probably damaging Het
Vmn2r23 A G 6: 123,713,002 D279G probably damaging Het
Wnt3a T C 11: 59,275,280 N58S probably damaging Het
Zkscan8 A G 13: 21,520,725 V276A probably damaging Het
Other mutations in Gucy1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Gucy1a1 APN 3 82111191 missense probably benign 0.00
IGL01626:Gucy1a1 APN 3 82108619 missense probably damaging 1.00
IGL01662:Gucy1a1 APN 3 82109253 missense possibly damaging 0.63
IGL02480:Gucy1a1 APN 3 82097733 missense probably damaging 1.00
IGL02902:Gucy1a1 APN 3 82118917 missense possibly damaging 0.87
IGL03022:Gucy1a1 APN 3 82109097 missense probably benign 0.30
IGL03056:Gucy1a1 APN 3 82113287 missense probably benign 0.00
IGL03089:Gucy1a1 APN 3 82097681 missense probably damaging 1.00
IGL03226:Gucy1a1 APN 3 82119024 missense probably benign 0.00
IGL03377:Gucy1a1 APN 3 82106015 missense probably damaging 1.00
R0245:Gucy1a1 UTSW 3 82108787 missense possibly damaging 0.67
R0762:Gucy1a1 UTSW 3 82094896 missense unknown
R0907:Gucy1a1 UTSW 3 82111191 missense probably benign 0.00
R1242:Gucy1a1 UTSW 3 82105953 splice site probably null
R1625:Gucy1a1 UTSW 3 82102055 missense probably benign 0.02
R1671:Gucy1a1 UTSW 3 82106222 missense probably damaging 1.00
R2056:Gucy1a1 UTSW 3 82109285 missense possibly damaging 0.89
R2094:Gucy1a1 UTSW 3 82113332 missense probably benign
R2140:Gucy1a1 UTSW 3 82118886 splice site probably null
R2154:Gucy1a1 UTSW 3 82111151 critical splice donor site probably null
R3418:Gucy1a1 UTSW 3 82106133 missense probably damaging 1.00
R3419:Gucy1a1 UTSW 3 82106133 missense probably damaging 1.00
R4290:Gucy1a1 UTSW 3 82094759 missense possibly damaging 0.95
R4291:Gucy1a1 UTSW 3 82094759 missense possibly damaging 0.95
R4292:Gucy1a1 UTSW 3 82094759 missense possibly damaging 0.95
R4294:Gucy1a1 UTSW 3 82094759 missense possibly damaging 0.95
R4573:Gucy1a1 UTSW 3 82108922 missense possibly damaging 0.95
R4629:Gucy1a1 UTSW 3 82097624 missense probably damaging 1.00
R4755:Gucy1a1 UTSW 3 82094795 missense probably benign 0.40
R4865:Gucy1a1 UTSW 3 82119162 utr 5 prime probably benign
R5933:Gucy1a1 UTSW 3 82094807 missense probably damaging 0.96
R6278:Gucy1a1 UTSW 3 82097634 missense probably damaging 1.00
R6385:Gucy1a1 UTSW 3 82109006 missense probably benign
R7011:Gucy1a1 UTSW 3 82109115 missense probably damaging 1.00
R7361:Gucy1a1 UTSW 3 82097720 missense probably damaging 1.00
R7648:Gucy1a1 UTSW 3 82108707 missense possibly damaging 0.63
R7709:Gucy1a1 UTSW 3 82094789 missense unknown
R7770:Gucy1a1 UTSW 3 82108805 missense possibly damaging 0.95
R8443:Gucy1a1 UTSW 3 82097693 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACATGAACGGAGTAGAGC -3'
(R):5'- TCTGAGCTGACCCACTTGATG -3'

Sequencing Primer
(F):5'- CAAATAGGGCTGGTTCACAAACTCG -3'
(R):5'- CGAGGAGCTGTTCAAGATCTGC -3'
Posted On2016-10-06