Incidental Mutation 'R5528:Phgdh'
ID433515
Institutional Source Beutler Lab
Gene Symbol Phgdh
Ensembl Gene ENSMUSG00000053398
Gene Name3-phosphoglycerate dehydrogenase
SynonymsPGD, 3-PGDH, A10, PGAD, PGDH, SERA, 3PGDH
MMRRC Submission 043086-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5528 (G1)
Quality Score122
Status Not validated
Chromosome3
Chromosomal Location98313170-98339990 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98328339 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 121 (I121V)
Ref Sequence ENSEMBL: ENSMUSP00000064755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065793]
Predicted Effect probably benign
Transcript: ENSMUST00000065793
AA Change: I121V

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000064755
Gene: ENSMUSG00000053398
AA Change: I121V

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 9 317 2.1e-42 PFAM
Pfam:2-Hacid_dh_C 111 285 3.5e-60 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000148488
AA Change: I92V
SMART Domains Protein: ENSMUSP00000117525
Gene: ENSMUSG00000053398
AA Change: I92V

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 7 145 1.1e-27 PFAM
Pfam:2-Hacid_dh_C 83 149 1.3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153694
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme which is involved in the early steps of L-serine synthesis in animal cells. L-serine is required for D-serine and other amino acid synthesis. The enzyme requires NAD/NADH as a cofactor and forms homotetramers for activity. Mutations in this gene have been found in a family with congenital microcephaly, psychomotor retardation and other symptoms. Multiple alternatively spliced transcript variants have been found, however the full-length nature of most are not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele die by E13.5 and exhibit abnormal neural development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,066,499 L483P probably benign Het
1700025F22Rik T C 19: 11,141,635 S37G possibly damaging Het
3110043O21Rik T C 4: 35,213,556 D198G probably benign Het
4930519G04Rik T G 5: 114,874,354 probably null Het
Ablim2 C T 5: 35,856,166 Q148* probably null Het
Ap3s2 A T 7: 79,880,486 *194R probably null Het
Arpp21 C T 9: 112,149,353 A235T probably benign Het
Ccdc33 T C 9: 58,028,795 D939G probably benign Het
Celsr2 A T 3: 108,413,294 I734N probably damaging Het
Clcn1 C A 6: 42,300,341 N455K probably benign Het
Cpne8 C T 15: 90,619,690 V91I possibly damaging Het
Ddx1 A G 12: 13,229,294 V448A probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Eif2a G T 3: 58,548,512 D311Y probably damaging Het
Eif2ak4 G A 2: 118,427,938 E512K probably damaging Het
Esp15 A T 17: 39,644,749 Y69F probably benign Het
Fam102a G A 2: 32,566,327 A334T probably damaging Het
Gm5689 A G 18: 42,173,662 probably null Het
Gucy1a1 A T 3: 82,109,073 Y203N probably damaging Het
Hook3 T C 8: 26,072,293 Q248R probably damaging Het
Ifit2 T A 19: 34,573,537 V159E possibly damaging Het
Il17rd T C 14: 27,088,067 V20A possibly damaging Het
Kcnq3 T A 15: 66,025,178 D291V probably damaging Het
Klf11 A T 12: 24,654,930 M111L probably benign Het
Lama5 T A 2: 180,194,563 H1165L probably benign Het
Lmo7 A G 14: 101,902,086 N702S probably damaging Het
Lta4h T C 10: 93,471,874 V323A probably damaging Het
Mkrn3 T C 7: 62,418,987 E352G possibly damaging Het
Mtf2 T A 5: 108,094,157 L277Q probably damaging Het
Myo9b A G 8: 71,323,274 N370D probably benign Het
Nlrp4e A C 7: 23,336,891 K723T probably benign Het
Nsun3 A G 16: 62,735,326 V279A possibly damaging Het
Pde6b A G 5: 108,423,558 D459G probably benign Het
Pik3r5 T C 11: 68,495,977 C811R probably damaging Het
Spaca6 A C 17: 17,831,082 I27L probably benign Het
Trmt1l G A 1: 151,454,995 V588I probably benign Het
Tshr A G 12: 91,537,193 N302D probably damaging Het
Vmn2r23 A G 6: 123,713,002 D279G probably damaging Het
Wnt3a T C 11: 59,275,280 N58S probably damaging Het
Zkscan8 A G 13: 21,520,725 V276A probably damaging Het
Other mutations in Phgdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Phgdh APN 3 98328315 missense probably damaging 1.00
R0195:Phgdh UTSW 3 98316550 unclassified probably benign
R0636:Phgdh UTSW 3 98333291 missense possibly damaging 0.89
R0787:Phgdh UTSW 3 98334549 missense probably damaging 1.00
R1626:Phgdh UTSW 3 98316409 missense probably benign 0.16
R1733:Phgdh UTSW 3 98328135 missense probably benign 0.00
R1782:Phgdh UTSW 3 98320747 missense probably damaging 0.97
R2173:Phgdh UTSW 3 98315111 missense probably benign 0.00
R2256:Phgdh UTSW 3 98328291 missense probably benign 0.30
R2367:Phgdh UTSW 3 98314296 missense probably benign 0.07
R2495:Phgdh UTSW 3 98339789 missense probably damaging 1.00
R4214:Phgdh UTSW 3 98328061 missense possibly damaging 0.79
R4410:Phgdh UTSW 3 98314275 missense probably benign
R5062:Phgdh UTSW 3 98328339 missense probably damaging 1.00
R5378:Phgdh UTSW 3 98321323 splice site probably null
R7357:Phgdh UTSW 3 98339822 missense probably benign 0.00
R7436:Phgdh UTSW 3 98339729 missense probably benign 0.34
R7894:Phgdh UTSW 3 98339808 missense probably damaging 0.98
R8373:Phgdh UTSW 3 98321245 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTTCTGTCCCCATGAACTG -3'
(R):5'- ACCAATGTTCTCACTGTCCCAG -3'

Sequencing Primer
(F):5'- TCTGTCCCCATGAACTGCAACC -3'
(R):5'- AGCCTTCCCTTATACACAGTGG -3'
Posted On2016-10-06