Incidental Mutation 'R5528:3110043O21Rik'
ID433518
Institutional Source Beutler Lab
Gene Symbol 3110043O21Rik
Ensembl Gene ENSMUSG00000028300
Gene NameRIKEN cDNA 3110043O21 gene
SynonymsC9orf72
MMRRC Submission 043086-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5528 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location35191285-35226175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35213556 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 198 (D198G)
Ref Sequence ENSEMBL: ENSMUSP00000081775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084724] [ENSMUST00000108126] [ENSMUST00000108127]
Predicted Effect probably benign
Transcript: ENSMUST00000084724
AA Change: D198G

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000081775
Gene: ENSMUSG00000028300
AA Change: D198G

DomainStartEndE-ValueType
Pfam:C9orf72-like 60 325 6.8e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108126
AA Change: D34G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000103761
Gene: ENSMUSG00000028300
AA Change: D34G

DomainStartEndE-ValueType
Pfam:C9orf72-like 1 161 2e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108127
AA Change: D198G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103762
Gene: ENSMUSG00000028300
AA Change: D198G

DomainStartEndE-ValueType
Pfam:C9orf72-like 61 324 1.9e-99 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156472
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays an important role in the regulation of endosomal trafficking, and has been shown to interact with Rab proteins that are involved in autophagy and endocytic transport. Expansion of a GGGGCC repeat from 2-22 copies to 700-1600 copies in the intronic sequence between alternate 5' exons in transcripts from this gene is associated with 9p-linked ALS (amyotrophic lateral sclerosis) and FTD (frontotemporal dementia) (PMID: 21944778, 21944779). Studies suggest that hexanucleotide expansions could result in the selective stabilization of repeat-containing pre-mRNA, and the accumulation of insoluble dipeptide repeat protein aggregates that could be pathogenic in FTD-ALS patients (PMID: 23393093). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2016]
PHENOTYPE: Nullizygous mice show splenomegaly and lymphadenopathy. Homozygotes for one allele show reduced body weight, hematocrit and hemoglobin content, lymphopenia, neutrophilia, social interaction deficits and premature death. Homozygotes for another allele show altered macrophage and microglia physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,066,499 L483P probably benign Het
1700025F22Rik T C 19: 11,141,635 S37G possibly damaging Het
4930519G04Rik T G 5: 114,874,354 probably null Het
Ablim2 C T 5: 35,856,166 Q148* probably null Het
Ap3s2 A T 7: 79,880,486 *194R probably null Het
Arpp21 C T 9: 112,149,353 A235T probably benign Het
Ccdc33 T C 9: 58,028,795 D939G probably benign Het
Celsr2 A T 3: 108,413,294 I734N probably damaging Het
Clcn1 C A 6: 42,300,341 N455K probably benign Het
Cpne8 C T 15: 90,619,690 V91I possibly damaging Het
Ddx1 A G 12: 13,229,294 V448A probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Eif2a G T 3: 58,548,512 D311Y probably damaging Het
Eif2ak4 G A 2: 118,427,938 E512K probably damaging Het
Esp15 A T 17: 39,644,749 Y69F probably benign Het
Fam102a G A 2: 32,566,327 A334T probably damaging Het
Gm5689 A G 18: 42,173,662 probably null Het
Gucy1a1 A T 3: 82,109,073 Y203N probably damaging Het
Hook3 T C 8: 26,072,293 Q248R probably damaging Het
Ifit2 T A 19: 34,573,537 V159E possibly damaging Het
Il17rd T C 14: 27,088,067 V20A possibly damaging Het
Kcnq3 T A 15: 66,025,178 D291V probably damaging Het
Klf11 A T 12: 24,654,930 M111L probably benign Het
Lama5 T A 2: 180,194,563 H1165L probably benign Het
Lmo7 A G 14: 101,902,086 N702S probably damaging Het
Lta4h T C 10: 93,471,874 V323A probably damaging Het
Mkrn3 T C 7: 62,418,987 E352G possibly damaging Het
Mtf2 T A 5: 108,094,157 L277Q probably damaging Het
Myo9b A G 8: 71,323,274 N370D probably benign Het
Nlrp4e A C 7: 23,336,891 K723T probably benign Het
Nsun3 A G 16: 62,735,326 V279A possibly damaging Het
Pde6b A G 5: 108,423,558 D459G probably benign Het
Phgdh T C 3: 98,328,339 I121V probably benign Het
Pik3r5 T C 11: 68,495,977 C811R probably damaging Het
Spaca6 A C 17: 17,831,082 I27L probably benign Het
Trmt1l G A 1: 151,454,995 V588I probably benign Het
Tshr A G 12: 91,537,193 N302D probably damaging Het
Vmn2r23 A G 6: 123,713,002 D279G probably damaging Het
Wnt3a T C 11: 59,275,280 N58S probably damaging Het
Zkscan8 A G 13: 21,520,725 V276A probably damaging Het
Other mutations in 3110043O21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:3110043O21Rik APN 4 35213616 missense possibly damaging 0.57
IGL00718:3110043O21Rik APN 4 35213015 missense probably damaging 1.00
IGL01284:3110043O21Rik APN 4 35218808 missense probably damaging 0.96
IGL01998:3110043O21Rik APN 4 35194179 missense probably benign 0.30
IGL02185:3110043O21Rik APN 4 35197046 missense probably damaging 1.00
IGL02403:3110043O21Rik APN 4 35205887 splice site probably benign
IGL02823:3110043O21Rik APN 4 35213031 missense probably damaging 0.98
R0194:3110043O21Rik UTSW 4 35197207 missense probably damaging 1.00
R0471:3110043O21Rik UTSW 4 35193257 missense probably benign 0.01
R1172:3110043O21Rik UTSW 4 35218630 missense probably damaging 0.99
R1175:3110043O21Rik UTSW 4 35218630 missense probably damaging 0.99
R1765:3110043O21Rik UTSW 4 35197098 missense probably damaging 1.00
R4326:3110043O21Rik UTSW 4 35225985 unclassified probably benign
R4327:3110043O21Rik UTSW 4 35225985 unclassified probably benign
R4328:3110043O21Rik UTSW 4 35225985 unclassified probably benign
R4679:3110043O21Rik UTSW 4 35226033 unclassified probably benign
R4844:3110043O21Rik UTSW 4 35213565 missense possibly damaging 0.47
R5150:3110043O21Rik UTSW 4 35193270 missense possibly damaging 0.92
R5789:3110043O21Rik UTSW 4 35226112 unclassified probably benign
R7790:3110043O21Rik UTSW 4 35192997 missense unknown
R7805:3110043O21Rik UTSW 4 35194170 missense
R8115:3110043O21Rik UTSW 4 35218763 missense
Predicted Primers PCR Primer
(F):5'- ACTCACGGAAAATGTGTGACTGG -3'
(R):5'- AGGGTGTTTTACTCTCTGCC -3'

Sequencing Primer
(F):5'- CGGAAAATGTGTGACTGGAATATTC -3'
(R):5'- ACTCTCTGCCTCCATTTGAAATG -3'
Posted On2016-10-06