Incidental Mutation 'R5528:Ablim2'
ID433521
Institutional Source Beutler Lab
Gene Symbol Ablim2
Ensembl Gene ENSMUSG00000029095
Gene Nameactin-binding LIM protein 2
Synonyms
MMRRC Submission 043086-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R5528 (G1)
Quality Score214
Status Not validated
Chromosome5
Chromosomal Location35757880-35884973 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 35856166 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 148 (Q148*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054598] [ENSMUST00000101280] [ENSMUST00000114203] [ENSMUST00000114204] [ENSMUST00000114205] [ENSMUST00000114206] [ENSMUST00000114210] [ENSMUST00000129347]
Predicted Effect probably benign
Transcript: ENSMUST00000054598
SMART Domains Protein: ENSMUSP00000050571
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 278 296 N/A INTRINSIC
low complexity region 364 373 N/A INTRINSIC
low complexity region 477 489 N/A INTRINSIC
VHP 577 612 2.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101280
SMART Domains Protein: ENSMUSP00000098838
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 297 315 N/A INTRINSIC
low complexity region 383 392 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
VHP 572 607 2.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114203
SMART Domains Protein: ENSMUSP00000109841
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
PDB:1WIG|A 1 28 5e-13 PDB
low complexity region 35 53 N/A INTRINSIC
low complexity region 132 141 N/A INTRINSIC
low complexity region 211 223 N/A INTRINSIC
VHP 311 346 2.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114204
SMART Domains Protein: ENSMUSP00000109842
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 278 296 N/A INTRINSIC
low complexity region 364 373 N/A INTRINSIC
low complexity region 510 522 N/A INTRINSIC
VHP 571 606 2.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114205
SMART Domains Protein: ENSMUSP00000109843
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 278 296 N/A INTRINSIC
low complexity region 364 373 N/A INTRINSIC
low complexity region 477 489 N/A INTRINSIC
VHP 538 573 2.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114206
SMART Domains Protein: ENSMUSP00000109844
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 278 296 N/A INTRINSIC
low complexity region 375 384 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
VHP 582 617 2.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114210
SMART Domains Protein: ENSMUSP00000109848
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 278 296 N/A INTRINSIC
low complexity region 364 373 N/A INTRINSIC
low complexity region 510 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125378
SMART Domains Protein: ENSMUSP00000115931
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
Pfam:AbLIM_anchor 1 115 6.3e-29 PFAM
low complexity region 136 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129347
SMART Domains Protein: ENSMUSP00000123525
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
Pfam:AbLIM_anchor 295 513 2.1e-78 PFAM
Pfam:AbLIM_anchor 497 628 2.6e-37 PFAM
VHP 629 664 2.34e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130209
Predicted Effect probably null
Transcript: ENSMUST00000151322
AA Change: Q148*
SMART Domains Protein: ENSMUSP00000114616
Gene: ENSMUSG00000029095
AA Change: Q148*

DomainStartEndE-ValueType
Pfam:AbLIM_anchor 12 164 4.3e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151636
SMART Domains Protein: ENSMUSP00000123616
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
Pfam:AbLIM_anchor 22 148 5.6e-54 PFAM
low complexity region 171 183 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153025
Predicted Effect probably benign
Transcript: ENSMUST00000153529
SMART Domains Protein: ENSMUSP00000118019
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
Pfam:AbLIM_anchor 43 73 1.7e-17 PFAM
VHP 74 109 2.34e-19 SMART
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,066,499 L483P probably benign Het
1700025F22Rik T C 19: 11,141,635 S37G possibly damaging Het
3110043O21Rik T C 4: 35,213,556 D198G probably benign Het
4930519G04Rik T G 5: 114,874,354 probably null Het
Ap3s2 A T 7: 79,880,486 *194R probably null Het
Arpp21 C T 9: 112,149,353 A235T probably benign Het
Ccdc33 T C 9: 58,028,795 D939G probably benign Het
Celsr2 A T 3: 108,413,294 I734N probably damaging Het
Clcn1 C A 6: 42,300,341 N455K probably benign Het
Cpne8 C T 15: 90,619,690 V91I possibly damaging Het
Ddx1 A G 12: 13,229,294 V448A probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Eif2a G T 3: 58,548,512 D311Y probably damaging Het
Eif2ak4 G A 2: 118,427,938 E512K probably damaging Het
Esp15 A T 17: 39,644,749 Y69F probably benign Het
Fam102a G A 2: 32,566,327 A334T probably damaging Het
Gm5689 A G 18: 42,173,662 probably null Het
Gucy1a1 A T 3: 82,109,073 Y203N probably damaging Het
Hook3 T C 8: 26,072,293 Q248R probably damaging Het
Ifit2 T A 19: 34,573,537 V159E possibly damaging Het
Il17rd T C 14: 27,088,067 V20A possibly damaging Het
Kcnq3 T A 15: 66,025,178 D291V probably damaging Het
Klf11 A T 12: 24,654,930 M111L probably benign Het
Lama5 T A 2: 180,194,563 H1165L probably benign Het
Lmo7 A G 14: 101,902,086 N702S probably damaging Het
Lta4h T C 10: 93,471,874 V323A probably damaging Het
Mkrn3 T C 7: 62,418,987 E352G possibly damaging Het
Mtf2 T A 5: 108,094,157 L277Q probably damaging Het
Myo9b A G 8: 71,323,274 N370D probably benign Het
Nlrp4e A C 7: 23,336,891 K723T probably benign Het
Nsun3 A G 16: 62,735,326 V279A possibly damaging Het
Pde6b A G 5: 108,423,558 D459G probably benign Het
Phgdh T C 3: 98,328,339 I121V probably benign Het
Pik3r5 T C 11: 68,495,977 C811R probably damaging Het
Spaca6 A C 17: 17,831,082 I27L probably benign Het
Trmt1l G A 1: 151,454,995 V588I probably benign Het
Tshr A G 12: 91,537,193 N302D probably damaging Het
Vmn2r23 A G 6: 123,713,002 D279G probably damaging Het
Wnt3a T C 11: 59,275,280 N58S probably damaging Het
Zkscan8 A G 13: 21,520,725 V276A probably damaging Het
Other mutations in Ablim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00939:Ablim2 APN 5 35824015 unclassified probably benign
IGL00945:Ablim2 APN 5 35837020 missense probably damaging 1.00
IGL02439:Ablim2 APN 5 35857862 missense possibly damaging 0.89
IGL02664:Ablim2 APN 5 35849516 missense probably damaging 1.00
IGL02897:Ablim2 APN 5 35833126 missense probably damaging 1.00
IGL03034:Ablim2 APN 5 35828165 missense probably benign 0.00
IGL03096:Ablim2 APN 5 35883399 nonsense probably null
IGL03384:Ablim2 APN 5 35874872 missense probably damaging 1.00
R0128:Ablim2 UTSW 5 35809176 splice site probably benign
R0130:Ablim2 UTSW 5 35809176 splice site probably benign
R0212:Ablim2 UTSW 5 35848910 splice site probably null
R0344:Ablim2 UTSW 5 35836933 splice site probably benign
R0675:Ablim2 UTSW 5 35866780 splice site probably benign
R0788:Ablim2 UTSW 5 35857901 missense probably benign 0.01
R1148:Ablim2 UTSW 5 35809261 missense probably damaging 1.00
R1148:Ablim2 UTSW 5 35809261 missense probably damaging 1.00
R1493:Ablim2 UTSW 5 35809261 missense probably damaging 1.00
R1809:Ablim2 UTSW 5 35843270 intron probably benign
R2070:Ablim2 UTSW 5 35798513 missense probably damaging 1.00
R2163:Ablim2 UTSW 5 35802353 splice site probably benign
R3962:Ablim2 UTSW 5 35812175 missense probably damaging 1.00
R4852:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4853:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4854:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4855:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4866:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4867:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4906:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4908:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4909:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4927:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R5210:Ablim2 UTSW 5 35837072 missense probably benign 0.44
R5225:Ablim2 UTSW 5 35866771 splice site probably null
R5439:Ablim2 UTSW 5 35857826 missense probably damaging 0.98
R5629:Ablim2 UTSW 5 35857163 missense probably benign 0.01
R5653:Ablim2 UTSW 5 35883412 missense probably damaging 1.00
R5921:Ablim2 UTSW 5 35812211 missense probably damaging 1.00
R6059:Ablim2 UTSW 5 35857164 missense probably benign 0.37
R6241:Ablim2 UTSW 5 35874897 missense probably damaging 1.00
R7492:Ablim2 UTSW 5 35841329 missense probably benign 0.14
R7562:Ablim2 UTSW 5 35873219 missense probably benign 0.00
R7960:Ablim2 UTSW 5 35857149 missense probably benign 0.01
R8414:Ablim2 UTSW 5 35874891 missense possibly damaging 0.95
Z1176:Ablim2 UTSW 5 35848858 missense possibly damaging 0.84
Z1177:Ablim2 UTSW 5 35824043 missense probably damaging 0.98
Z1177:Ablim2 UTSW 5 35841293 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GCAGAGGGTTTATTTCCAACTG -3'
(R):5'- TCAGGACTCAGACAGTGCAG -3'

Sequencing Primer
(F):5'- CAGAGGGTTTATTTCCAACTGAAAAC -3'
(R):5'- CTCAGACAGTGCAGGGAGAC -3'
Posted On2016-10-06