Incidental Mutation 'R5528:Mtf2'
ID433522
Institutional Source Beutler Lab
Gene Symbol Mtf2
Ensembl Gene ENSMUSG00000029267
Gene Namemetal response element binding transcription factor 2
SynonymsPcl2, C76717, 9230112N11Rik, M96
MMRRC Submission 043086-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.856) question?
Stock #R5528 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location108065674-108109004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108094157 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 277 (L277Q)
Ref Sequence ENSEMBL: ENSMUSP00000108245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081567] [ENSMUST00000112626] [ENSMUST00000124195] [ENSMUST00000134026] [ENSMUST00000143412] [ENSMUST00000170319]
Predicted Effect probably damaging
Transcript: ENSMUST00000081567
AA Change: L277Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080278
Gene: ENSMUSG00000029267
AA Change: L277Q

DomainStartEndE-ValueType
TUDOR 44 101 4.09e-13 SMART
PHD 104 155 3.37e-11 SMART
PHD 203 253 1.23e-4 SMART
low complexity region 496 508 N/A INTRINSIC
Pfam:Mtf2_C 544 591 2.8e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112626
AA Change: L277Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108245
Gene: ENSMUSG00000029267
AA Change: L277Q

DomainStartEndE-ValueType
TUDOR 44 101 4.09e-13 SMART
PHD 104 155 3.37e-11 SMART
PHD 203 253 1.23e-4 SMART
low complexity region 439 451 N/A INTRINSIC
Pfam:Mtf2_C 485 535 5.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124195
SMART Domains Protein: ENSMUSP00000126297
Gene: ENSMUSG00000029267

DomainStartEndE-ValueType
PDB:2EQJ|A 36 70 2e-17 PDB
Blast:TUDOR 44 75 7e-13 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000129921
AA Change: L51Q
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131291
Predicted Effect probably benign
Transcript: ENSMUST00000134026
SMART Domains Protein: ENSMUSP00000128797
Gene: ENSMUSG00000029267

DomainStartEndE-ValueType
TUDOR 44 101 4.09e-13 SMART
PHD 104 155 3.37e-11 SMART
PHD 203 253 1.23e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000137996
AA Change: L182Q
SMART Domains Protein: ENSMUSP00000121697
Gene: ENSMUSG00000029267
AA Change: L182Q

DomainStartEndE-ValueType
PHD 10 61 3.37e-11 SMART
PHD 109 159 1.23e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141592
Predicted Effect probably benign
Transcript: ENSMUST00000143412
SMART Domains Protein: ENSMUSP00000132596
Gene: ENSMUSG00000029267

DomainStartEndE-ValueType
TUDOR 44 101 1.22e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170319
AA Change: L159Q

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130536
Gene: ENSMUSG00000029267
AA Change: L159Q

DomainStartEndE-ValueType
PHD 1 37 6.4e-3 SMART
PHD 85 135 1.23e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198662
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit vertebral transformation and delayed replicative senescence in MEFs. Mice homozygous for one gene trap allele exhibit postnatal lethality, vertebral transformation and delayed replicative senescence in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,066,499 L483P probably benign Het
1700025F22Rik T C 19: 11,141,635 S37G possibly damaging Het
3110043O21Rik T C 4: 35,213,556 D198G probably benign Het
4930519G04Rik T G 5: 114,874,354 probably null Het
Ablim2 C T 5: 35,856,166 Q148* probably null Het
Ap3s2 A T 7: 79,880,486 *194R probably null Het
Arpp21 C T 9: 112,149,353 A235T probably benign Het
Ccdc33 T C 9: 58,028,795 D939G probably benign Het
Celsr2 A T 3: 108,413,294 I734N probably damaging Het
Clcn1 C A 6: 42,300,341 N455K probably benign Het
Cpne8 C T 15: 90,619,690 V91I possibly damaging Het
Ddx1 A G 12: 13,229,294 V448A probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Eif2a G T 3: 58,548,512 D311Y probably damaging Het
Eif2ak4 G A 2: 118,427,938 E512K probably damaging Het
Esp15 A T 17: 39,644,749 Y69F probably benign Het
Fam102a G A 2: 32,566,327 A334T probably damaging Het
Gm5689 A G 18: 42,173,662 probably null Het
Gucy1a1 A T 3: 82,109,073 Y203N probably damaging Het
Hook3 T C 8: 26,072,293 Q248R probably damaging Het
Ifit2 T A 19: 34,573,537 V159E possibly damaging Het
Il17rd T C 14: 27,088,067 V20A possibly damaging Het
Kcnq3 T A 15: 66,025,178 D291V probably damaging Het
Klf11 A T 12: 24,654,930 M111L probably benign Het
Lama5 T A 2: 180,194,563 H1165L probably benign Het
Lmo7 A G 14: 101,902,086 N702S probably damaging Het
Lta4h T C 10: 93,471,874 V323A probably damaging Het
Mkrn3 T C 7: 62,418,987 E352G possibly damaging Het
Myo9b A G 8: 71,323,274 N370D probably benign Het
Nlrp4e A C 7: 23,336,891 K723T probably benign Het
Nsun3 A G 16: 62,735,326 V279A possibly damaging Het
Pde6b A G 5: 108,423,558 D459G probably benign Het
Phgdh T C 3: 98,328,339 I121V probably benign Het
Pik3r5 T C 11: 68,495,977 C811R probably damaging Het
Spaca6 A C 17: 17,831,082 I27L probably benign Het
Trmt1l G A 1: 151,454,995 V588I probably benign Het
Tshr A G 12: 91,537,193 N302D probably damaging Het
Vmn2r23 A G 6: 123,713,002 D279G probably damaging Het
Wnt3a T C 11: 59,275,280 N58S probably damaging Het
Zkscan8 A G 13: 21,520,725 V276A probably damaging Het
Other mutations in Mtf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Mtf2 APN 5 108106890 missense probably damaging 1.00
IGL01367:Mtf2 APN 5 108104457 missense probably benign 0.44
IGL01452:Mtf2 APN 5 108080943 missense probably damaging 1.00
IGL01459:Mtf2 APN 5 108080943 missense probably damaging 1.00
IGL01460:Mtf2 APN 5 108080943 missense probably damaging 1.00
IGL01809:Mtf2 APN 5 108087325 missense probably benign 0.27
IGL03166:Mtf2 APN 5 108106720 missense probably benign 0.28
R0667:Mtf2 UTSW 5 108104503 missense probably damaging 1.00
R1533:Mtf2 UTSW 5 108092129 missense probably damaging 1.00
R1664:Mtf2 UTSW 5 108104476 missense probably damaging 1.00
R1723:Mtf2 UTSW 5 108088070 missense probably damaging 1.00
R2154:Mtf2 UTSW 5 108080931 missense possibly damaging 0.79
R2213:Mtf2 UTSW 5 108100914 missense possibly damaging 0.95
R3904:Mtf2 UTSW 5 108081000 missense probably damaging 1.00
R4320:Mtf2 UTSW 5 108087025 missense probably damaging 1.00
R4560:Mtf2 UTSW 5 108086989 splice site probably null
R4764:Mtf2 UTSW 5 108093352 missense probably benign 0.43
R4989:Mtf2 UTSW 5 108073028 intron probably benign
R5305:Mtf2 UTSW 5 108104499 missense possibly damaging 0.84
R5356:Mtf2 UTSW 5 108106610 missense possibly damaging 0.92
R6021:Mtf2 UTSW 5 108081137 missense possibly damaging 0.93
R7164:Mtf2 UTSW 5 108093369 missense possibly damaging 0.53
R7426:Mtf2 UTSW 5 108100970 missense probably benign
R7822:Mtf2 UTSW 5 108080877 nonsense probably null
R8033:Mtf2 UTSW 5 108087085 missense probably damaging 0.99
Z1088:Mtf2 UTSW 5 108087329 missense probably damaging 0.97
Z1176:Mtf2 UTSW 5 108087944 missense probably damaging 1.00
Z1177:Mtf2 UTSW 5 108065902 start gained probably benign
Z1177:Mtf2 UTSW 5 108080888 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- AAGCTAGTGGTTTCCAGTTTCTTC -3'
(R):5'- ACAGTAGCTCTGATATCCTTACCAAAG -3'

Sequencing Primer
(F):5'- CTAGTGGTTTCCAGTTTCTTCATATG -3'
(R):5'- CTCTGATATCCTTACCAAAGTGTTTC -3'
Posted On2016-10-06