Mutagenetix > Incidental Mutations

Incidental Mutation 'R5528:Pde6b'

433523

Institutional Source

Beutler Lab

Gene Symbol

Pde6b

Ensembl Gene

ENSMUSG00000029491

Gene Name

phosphodiesterase 6B, cGMP, rod receptor, beta polypeptide

Synonyms

rd10, Pdeb, rd, rd1, r

MMRRC Submission

043086-MU

Accession Numbers

Genbank: NM_008806; MGI: 97525

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5528 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

108388391-108432397 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 108423558 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 459 (D459G)

Ref Sequence

ENSEMBL: ENSMUSP00000031456 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031456]

Predicted Effect

probably benign
Transcript: ENSMUST00000031456
AA Change: D459G

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000031456
Gene: ENSMUSG00000029491
AA Change: D459G

Domain	Start	End	E-Value	Type
GAF	71	230	1.29e-27	SMART
GAF	252	439	5.76e-25	SMART
Blast:HDc	484	538	1e-24	BLAST
HDc	554	732	1.25e-9	SMART
Blast:HDc	757	792	8e-13	BLAST
low complexity region	813	837	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134865

Coding Region Coverage

1x: 98.6%
3x: 97.4%
10x: 95.4%
20x: 91.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Photon absorption triggers a signaling cascade in rod photoreceptors that activates cGMP phosphodiesterase (PDE), resulting in the rapid hydrolysis of cGMP, closure of cGMP-gated cation channels, and hyperpolarization of the cell. PDE is a peripheral membrane heterotrimeric enzyme made up of alpha, beta, and gamma subunits. This gene encodes the beta subunit. Mutations in this gene result in retinitis pigmentosa and autosomal dominant congenital stationary night blindness. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygotes for the rd1 mutation have severe retinal degeneration and vision loss. Rod cells are lost by 35 days of age; cone cells degenerate slower and some light sensitivity persists. Other allelic mutations produce similar or milder phenotypes. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(1) Targeted, other(1) Spontaneous(2) Chemically induced(9)

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	C	3: 138,066,499	L483P	probably benign	Het
1700025F22Rik	T	C	19: 11,141,635	S37G	possibly damaging	Het
3110043O21Rik	T	C	4: 35,213,556	D198G	probably benign	Het
4930519G04Rik	T	G	5: 114,874,354		probably null	Het
Ablim2	C	T	5: 35,856,166	Q148*	probably null	Het
Ap3s2	A	T	7: 79,880,486	*194R	probably null	Het
Arpp21	C	T	9: 112,149,353	A235T	probably benign	Het
Ccdc33	T	C	9: 58,028,795	D939G	probably benign	Het
Celsr2	A	T	3: 108,413,294	I734N	probably damaging	Het
Clcn1	C	A	6: 42,300,341	N455K	probably benign	Het
Cpne8	C	T	15: 90,619,690	V91I	possibly damaging	Het
Ddx1	A	G	12: 13,229,294	V448A	probably damaging	Het
Dnhd1	G	A	7: 105,703,209	R2523Q	probably damaging	Het
Eif2a	G	T	3: 58,548,512	D311Y	probably damaging	Het
Eif2ak4	G	A	2: 118,427,938	E512K	probably damaging	Het
Esp15	A	T	17: 39,644,749	Y69F	probably benign	Het
Fam102a	G	A	2: 32,566,327	A334T	probably damaging	Het
Gm5689	A	G	18: 42,173,662		probably null	Het
Gucy1a1	A	T	3: 82,109,073	Y203N	probably damaging	Het
Hook3	T	C	8: 26,072,293	Q248R	probably damaging	Het
Ifit2	T	A	19: 34,573,537	V159E	possibly damaging	Het
Il17rd	T	C	14: 27,088,067	V20A	possibly damaging	Het
Kcnq3	T	A	15: 66,025,178	D291V	probably damaging	Het
Klf11	A	T	12: 24,654,930	M111L	probably benign	Het
Lama5	T	A	2: 180,194,563	H1165L	probably benign	Het
Lmo7	A	G	14: 101,902,086	N702S	probably damaging	Het
Lta4h	T	C	10: 93,471,874	V323A	probably damaging	Het
Mkrn3	T	C	7: 62,418,987	E352G	possibly damaging	Het
Mtf2	T	A	5: 108,094,157	L277Q	probably damaging	Het
Myo9b	A	G	8: 71,323,274	N370D	probably benign	Het
Nlrp4e	A	C	7: 23,336,891	K723T	probably benign	Het
Nsun3	A	G	16: 62,735,326	V279A	possibly damaging	Het
Phgdh	T	C	3: 98,328,339	I121V	probably benign	Het
Pik3r5	T	C	11: 68,495,977	C811R	probably damaging	Het
Spaca6	A	C	17: 17,831,082	I27L	probably benign	Het
Trmt1l	G	A	1: 151,454,995	V588I	probably benign	Het
Tshr	A	G	12: 91,537,193	N302D	probably damaging	Het
Vmn2r23	A	G	6: 123,713,002	D279G	probably damaging	Het
Wnt3a	T	C	11: 59,275,280	N58S	probably damaging	Het
Zkscan8	A	G	13: 21,520,725	V276A	probably damaging	Het

Other mutations in Pde6b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00534:Pde6b	APN	5	108426571	splice site	probably benign
IGL01071:Pde6b	APN	5	108419715	nonsense	probably null
IGL01335:Pde6b	APN	5	108423513	missense	probably benign	0.03
IGL01611:Pde6b	APN	5	108403396	missense	possibly damaging	0.90
IGL01881:Pde6b	APN	5	108421500	missense	probably benign	0.01
IGL01941:Pde6b	APN	5	108423036	missense	probably benign	0.11
IGL02616:Pde6b	APN	5	108431541	missense	probably benign	0.05
IGL02657:Pde6b	APN	5	108420276	splice site	probably benign
IGL03217:Pde6b	APN	5	108419566	missense	probably damaging	1.00
Bemr28	UTSW	5		unclassified
D4043:Pde6b	UTSW	5	108425356	nonsense	probably null
N/A:Pde6b	UTSW	5	108429103	unclassified	probably benign
PIT4362001:Pde6b	UTSW	5	108423585	critical splice donor site	probably null
PIT4581001:Pde6b	UTSW	5	108428508	missense	probably benign	0.01
R0940:Pde6b	UTSW	5	108420337	missense	possibly damaging	0.95
R0963:Pde6b	UTSW	5	108430668	missense	probably benign
R1738:Pde6b	UTSW	5	108430559	nonsense	probably null
R1753:Pde6b	UTSW	5	108388691	nonsense	probably null
R1801:Pde6b	UTSW	5	108427847	missense	possibly damaging	0.51
R1913:Pde6b	UTSW	5	108427190	missense	probably benign	0.05
R2131:Pde6b	UTSW	5	108428203	missense	probably damaging	1.00
R2282:Pde6b	UTSW	5	108423586	splice site	probably null
R3713:Pde6b	UTSW	5	108423062	missense	probably damaging	1.00
R4385:Pde6b	UTSW	5	108427642	missense	probably benign	0.08
R4562:Pde6b	UTSW	5	108403368	missense	probably benign	0.23
R4582:Pde6b	UTSW	5	108425231	critical splice acceptor site	probably null
R4939:Pde6b	UTSW	5	108421497	missense	probably benign	0.01
R4950:Pde6b	UTSW	5	108430703	missense	probably benign	0.16
R4972:Pde6b	UTSW	5	108425264	missense	probably benign	0.00
R4983:Pde6b	UTSW	5	108425330	missense	probably benign	0.21
R5056:Pde6b	UTSW	5	108423491	nonsense	probably null
R5514:Pde6b	UTSW	5	108423451	missense	probably benign	0.06
R5937:Pde6b	UTSW	5	108424327	missense	probably benign	0.00
R6556:Pde6b	UTSW	5	108421501	missense	possibly damaging	0.56
R6826:Pde6b	UTSW	5	108430592	nonsense	probably null
R6884:Pde6b	UTSW	5	108388708	missense	probably damaging	0.99
R7213:Pde6b	UTSW	5	108404090	missense	probably damaging	1.00
R7444:Pde6b	UTSW	5	108427142	nonsense	probably null
R7690:Pde6b	UTSW	5	108419518	missense	probably damaging	1.00
R7909:Pde6b	UTSW	5	108403422	missense	probably benign	0.01
R7937:Pde6b	UTSW	5	108419773	critical splice donor site	probably null
R8049:Pde6b	UTSW	5	108425252	missense	probably benign	0.04
R8087:Pde6b	UTSW	5	108388462	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTGTAGCAGTCTGGGAAACTGG -3'
(R):5'- CTGCTTAGGATGAGGCACAG -3'

Sequencing Primer
(F):5'- GGAAACTGGCCTCTGAGACAC -3'
(R):5'- GGCACAGGGACAGTGTCTG -3'

Posted On

2016-10-06