Mutagenetix > Incidental Mutation

Incidental Mutation 'R5528:Vmn2r23'

433526

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r23

Ensembl Gene

ENSMUSG00000091620

Gene Name

vomeronasal 2, receptor 23

Synonyms

EG435916

MMRRC Submission

043086-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.070) question?

Stock #

R5528 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

123702821-123742291 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 123713002 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 279 (D279G)

Ref Sequence

ENSEMBL: ENSMUSP00000126682 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172391]

AlphaFold

E9PXI5

Predicted Effect

probably damaging
Transcript: ENSMUST00000172391
AA Change: D279G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: D279G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	79	461	1.7e-31	PFAM
Pfam:NCD3G	513	566	1.2e-23	PFAM
Pfam:7tm_3	596	834	1.5e-55	PFAM

Coding Region Coverage

1x: 98.6%
3x: 97.4%
10x: 95.4%
20x: 91.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	C	3: 138,066,499	L483P	probably benign	Het
1700025F22Rik	T	C	19: 11,141,635	S37G	possibly damaging	Het
3110043O21Rik	T	C	4: 35,213,556	D198G	probably benign	Het
4930519G04Rik	T	G	5: 114,874,354		probably null	Het
Ablim2	C	T	5: 35,856,166	Q148*	probably null	Het
Ap3s2	A	T	7: 79,880,486	*194R	probably null	Het
Arpp21	C	T	9: 112,149,353	A235T	probably benign	Het
Ccdc33	T	C	9: 58,028,795	D939G	probably benign	Het
Celsr2	A	T	3: 108,413,294	I734N	probably damaging	Het
Clcn1	C	A	6: 42,300,341	N455K	probably benign	Het
Cpne8	C	T	15: 90,619,690	V91I	possibly damaging	Het
Ddx1	A	G	12: 13,229,294	V448A	probably damaging	Het
Dnhd1	G	A	7: 105,703,209	R2523Q	probably damaging	Het
Eif2a	G	T	3: 58,548,512	D311Y	probably damaging	Het
Eif2ak4	G	A	2: 118,427,938	E512K	probably damaging	Het
Esp15	A	T	17: 39,644,749	Y69F	probably benign	Het
Fam102a	G	A	2: 32,566,327	A334T	probably damaging	Het
Gm5689	A	G	18: 42,173,662		probably null	Het
Gucy1a1	A	T	3: 82,109,073	Y203N	probably damaging	Het
Hook3	T	C	8: 26,072,293	Q248R	probably damaging	Het
Ifit2	T	A	19: 34,573,537	V159E	possibly damaging	Het
Il17rd	T	C	14: 27,088,067	V20A	possibly damaging	Het
Kcnq3	T	A	15: 66,025,178	D291V	probably damaging	Het
Klf11	A	T	12: 24,654,930	M111L	probably benign	Het
Lama5	T	A	2: 180,194,563	H1165L	probably benign	Het
Lmo7	A	G	14: 101,902,086	N702S	probably damaging	Het
Lta4h	T	C	10: 93,471,874	V323A	probably damaging	Het
Mkrn3	T	C	7: 62,418,987	E352G	possibly damaging	Het
Mtf2	T	A	5: 108,094,157	L277Q	probably damaging	Het
Myo9b	A	G	8: 71,323,274	N370D	probably benign	Het
Nlrp4e	A	C	7: 23,336,891	K723T	probably benign	Het
Nsun3	A	G	16: 62,735,326	V279A	possibly damaging	Het
Pde6b	A	G	5: 108,423,558	D459G	probably benign	Het
Phgdh	T	C	3: 98,328,339	I121V	probably benign	Het
Pik3r5	T	C	11: 68,495,977	C811R	probably damaging	Het
Spaca6	A	C	17: 17,831,082	I27L	probably benign	Het
Trmt1l	G	A	1: 151,454,995	V588I	probably benign	Het
Tshr	A	G	12: 91,537,193	N302D	probably damaging	Het
Wnt3a	T	C	11: 59,275,280	N58S	probably damaging	Het
Zkscan8	A	G	13: 21,520,725	V276A	probably damaging	Het

Other mutations in Vmn2r23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Vmn2r23	APN	6	123729725	missense	possibly damaging	0.89
IGL01012:Vmn2r23	APN	6	123729596	missense	probably benign
IGL01073:Vmn2r23	APN	6	123712800	missense	possibly damaging	0.82
IGL01547:Vmn2r23	APN	6	123704424	missense	possibly damaging	0.88
IGL01571:Vmn2r23	APN	6	123704407	missense	probably damaging	1.00
IGL01950:Vmn2r23	APN	6	123741886	missense	possibly damaging	0.80
IGL02028:Vmn2r23	APN	6	123741860	missense	probably damaging	1.00
IGL02248:Vmn2r23	APN	6	123741744	missense	probably damaging	0.96
IGL02318:Vmn2r23	APN	6	123741836	missense	probably benign	0.10
IGL02649:Vmn2r23	APN	6	123704478	missense	probably benign
IGL02831:Vmn2r23	APN	6	123704385	missense	probably benign	0.22
IGL02832:Vmn2r23	APN	6	123704396	missense	probably benign	0.00
IGL02865:Vmn2r23	APN	6	123741619	missense	probably damaging	1.00
IGL02964:Vmn2r23	APN	6	123741782	missense	possibly damaging	0.93
IGL03347:Vmn2r23	APN	6	123704374	missense	probably benign	0.01
IGL03396:Vmn2r23	APN	6	123729626	missense	probably damaging	1.00
PIT4472001:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R0597:Vmn2r23	UTSW	6	123729721	missense	probably benign	0.08
R0677:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R0904:Vmn2r23	UTSW	6	123742135	missense	probably damaging	1.00
R1330:Vmn2r23	UTSW	6	123742004	missense	probably damaging	1.00
R1424:Vmn2r23	UTSW	6	123713270	nonsense	probably null
R1629:Vmn2r23	UTSW	6	123713427	missense	probably benign	0.05
R1842:Vmn2r23	UTSW	6	123729690	missense	possibly damaging	0.77
R1867:Vmn2r23	UTSW	6	123702915	missense	probably damaging	1.00
R1919:Vmn2r23	UTSW	6	123713010	missense	possibly damaging	0.94
R2087:Vmn2r23	UTSW	6	123741499	missense	probably benign	0.00
R2338:Vmn2r23	UTSW	6	123704425	missense	possibly damaging	0.88
R2568:Vmn2r23	UTSW	6	123742188	nonsense	probably null
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R3500:Vmn2r23	UTSW	6	123713170	missense	possibly damaging	0.81
R3789:Vmn2r23	UTSW	6	123741389	missense	probably damaging	1.00
R4164:Vmn2r23	UTSW	6	123729738	missense	probably benign
R4506:Vmn2r23	UTSW	6	123702925	missense	probably damaging	1.00
R4652:Vmn2r23	UTSW	6	123741730	missense	probably damaging	1.00
R4697:Vmn2r23	UTSW	6	123741826	missense	probably damaging	1.00
R4840:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R4983:Vmn2r23	UTSW	6	123733349	missense	probably damaging	1.00
R5276:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R5392:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R5529:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R5664:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R5749:Vmn2r23	UTSW	6	123733273	missense	probably benign
R5761:Vmn2r23	UTSW	6	123712759	missense	probably benign	0.39
R5762:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R5868:Vmn2r23	UTSW	6	123712942	missense	probably benign	0.12
R5935:Vmn2r23	UTSW	6	123741895	missense	possibly damaging	0.94
R6242:Vmn2r23	UTSW	6	123704400	missense	possibly damaging	0.82
R6416:Vmn2r23	UTSW	6	123712902	missense	probably damaging	1.00
R6524:Vmn2r23	UTSW	6	123713425	missense	probably damaging	1.00
R6576:Vmn2r23	UTSW	6	123733273	missense	probably benign
R6925:Vmn2r23	UTSW	6	123704553	missense	probably damaging	1.00
R7148:Vmn2r23	UTSW	6	123713022	missense	probably benign
R7215:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R7252:Vmn2r23	UTSW	6	123741581	missense	probably damaging	0.97
R7403:Vmn2r23	UTSW	6	123704579	missense	probably benign	0.01
R8015:Vmn2r23	UTSW	6	123704541	missense	probably benign	0.00
R8143:Vmn2r23	UTSW	6	123741353	missense	probably damaging	0.99
R8474:Vmn2r23	UTSW	6	123704640	missense	probably benign	0.36
R8520:Vmn2r23	UTSW	6	123741656	missense	probably damaging	0.99
R8679:Vmn2r23	UTSW	6	123713472	missense	probably damaging	0.99
R8713:Vmn2r23	UTSW	6	123703032	missense
R8966:Vmn2r23	UTSW	6	123742120	missense	possibly damaging	0.94
R9124:Vmn2r23	UTSW	6	123742079	missense	possibly damaging	0.57
R9163:Vmn2r23	UTSW	6	123741823	missense	probably damaging	1.00
R9189:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R9451:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R9495:Vmn2r23	UTSW	6	123712713	missense	probably benign	0.30
R9514:Vmn2r23	UTSW	6	123712713	missense	probably benign	0.30
RF018:Vmn2r23	UTSW	6	123713116	missense	probably benign	0.00
T0975:Vmn2r23	UTSW	6	123713161	missense	probably benign	0.00
Z1088:Vmn2r23	UTSW	6	123742108	missense	probably damaging	0.98
Z1177:Vmn2r23	UTSW	6	123729725	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- ATATGCGGGGAGAACTCTTCC -3'
(R):5'- ATGGACCACACATCCTGGATAAAG -3'

Sequencing Primer
(F):5'- GGAGAACTCTTCCTTAGGGACATC -3'
(R):5'- GGTTGAACGTCTCTGAGAAAATCC -3'

Posted On

2016-10-06