Incidental Mutation 'R5528:Nlrp4e'
ID 433527
Institutional Source Beutler Lab
Gene Symbol Nlrp4e
Ensembl Gene ENSMUSG00000045693
Gene Name NLR family, pyrin domain containing 4E
Synonyms 4930406H16Rik, Nalp4e, Nalp-epsilon
MMRRC Submission 043086-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5528 (G1)
Quality Score 148
Status Not validated
Chromosome 7
Chromosomal Location 23000617-23061702 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 23036316 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Threonine at position 723 (K723T)
Ref Sequence ENSEMBL: ENSMUSP00000075794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076470]
AlphaFold Q66X19
Predicted Effect probably benign
Transcript: ENSMUST00000076470
AA Change: K723T

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000075794
Gene: ENSMUSG00000045693
AA Change: K723T

DomainStartEndE-ValueType
PYRIN 6 89 1.43e-35 SMART
Pfam:NACHT 148 317 1.3e-39 PFAM
LRR 689 716 1.87e1 SMART
LRR 718 745 7.74e0 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 2.67e1 SMART
LRR 802 829 6.48e-1 SMART
LRR 831 858 2.03e0 SMART
LRR 859 886 2.88e-6 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 1.02e2 SMART
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 137,772,260 (GRCm39) L483P probably benign Het
4930519G04Rik T G 5: 115,012,415 (GRCm39) probably null Het
Ablim2 C T 5: 36,013,510 (GRCm39) Q148* probably null Het
Ap3s2 A T 7: 79,530,234 (GRCm39) *194R probably null Het
Arpp21 C T 9: 111,978,421 (GRCm39) A235T probably benign Het
C9orf72 T C 4: 35,213,556 (GRCm39) D198G probably benign Het
Ccdc33 T C 9: 57,936,078 (GRCm39) D939G probably benign Het
Celsr2 A T 3: 108,320,610 (GRCm39) I734N probably damaging Het
Clcn1 C A 6: 42,277,275 (GRCm39) N455K probably benign Het
Cpne8 C T 15: 90,503,893 (GRCm39) V91I possibly damaging Het
Cstdc7 A G 18: 42,306,727 (GRCm39) probably null Het
Ddx1 A G 12: 13,279,295 (GRCm39) V448A probably damaging Het
Dnhd1 G A 7: 105,352,416 (GRCm39) R2523Q probably damaging Het
Eeig1 G A 2: 32,456,339 (GRCm39) A334T probably damaging Het
Eif2a G T 3: 58,455,933 (GRCm39) D311Y probably damaging Het
Eif2ak4 G A 2: 118,258,419 (GRCm39) E512K probably damaging Het
Esp15 A T 17: 39,955,640 (GRCm39) Y69F probably benign Het
Gucy1a1 A T 3: 82,016,380 (GRCm39) Y203N probably damaging Het
Hook3 T C 8: 26,562,321 (GRCm39) Q248R probably damaging Het
Ifit2 T A 19: 34,550,937 (GRCm39) V159E possibly damaging Het
Il17rd T C 14: 26,810,024 (GRCm39) V20A possibly damaging Het
Kcnq3 T A 15: 65,897,027 (GRCm39) D291V probably damaging Het
Klf11 A T 12: 24,704,929 (GRCm39) M111L probably benign Het
Lama5 T A 2: 179,836,356 (GRCm39) H1165L probably benign Het
Lmo7 A G 14: 102,139,522 (GRCm39) N702S probably damaging Het
Lta4h T C 10: 93,307,736 (GRCm39) V323A probably damaging Het
Mkrn3 T C 7: 62,068,735 (GRCm39) E352G possibly damaging Het
Ms4a19 T C 19: 11,118,999 (GRCm39) S37G possibly damaging Het
Mtf2 T A 5: 108,242,023 (GRCm39) L277Q probably damaging Het
Myo9b A G 8: 71,775,918 (GRCm39) N370D probably benign Het
Nsun3 A G 16: 62,555,689 (GRCm39) V279A possibly damaging Het
Pde6b A G 5: 108,571,424 (GRCm39) D459G probably benign Het
Phgdh T C 3: 98,235,655 (GRCm39) I121V probably benign Het
Pik3r5 T C 11: 68,386,803 (GRCm39) C811R probably damaging Het
Spaca6 A C 17: 18,051,344 (GRCm39) I27L probably benign Het
Trmt1l G A 1: 151,330,746 (GRCm39) V588I probably benign Het
Tshr A G 12: 91,503,967 (GRCm39) N302D probably damaging Het
Vmn2r23 A G 6: 123,689,961 (GRCm39) D279G probably damaging Het
Wnt3a T C 11: 59,166,106 (GRCm39) N58S probably damaging Het
Zkscan8 A G 13: 21,704,895 (GRCm39) V276A probably damaging Het
Other mutations in Nlrp4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Nlrp4e APN 7 23,042,565 (GRCm39) missense probably damaging 1.00
IGL00833:Nlrp4e APN 7 23,039,896 (GRCm39) missense probably benign 0.00
IGL01017:Nlrp4e APN 7 23,021,092 (GRCm39) missense possibly damaging 0.93
IGL01025:Nlrp4e APN 7 23,052,586 (GRCm39) splice site probably benign
IGL01815:Nlrp4e APN 7 23,020,863 (GRCm39) missense probably benign 0.02
IGL01924:Nlrp4e APN 7 23,020,255 (GRCm39) nonsense probably null
IGL02245:Nlrp4e APN 7 23,020,300 (GRCm39) missense probably damaging 1.00
IGL02745:Nlrp4e APN 7 23,020,716 (GRCm39) missense probably damaging 1.00
IGL02746:Nlrp4e APN 7 23,021,264 (GRCm39) missense probably benign 0.00
IGL02987:Nlrp4e APN 7 23,000,858 (GRCm39) missense probably damaging 1.00
IGL02997:Nlrp4e APN 7 23,000,799 (GRCm39) missense probably benign 0.04
IGL03193:Nlrp4e APN 7 23,020,251 (GRCm39) missense probably damaging 1.00
IGL03304:Nlrp4e APN 7 23,052,768 (GRCm39) critical splice donor site probably null
IGL03352:Nlrp4e APN 7 23,020,251 (GRCm39) missense probably damaging 1.00
R0389:Nlrp4e UTSW 7 23,054,628 (GRCm39) missense probably damaging 0.98
R1028:Nlrp4e UTSW 7 23,021,169 (GRCm39) missense probably damaging 1.00
R1163:Nlrp4e UTSW 7 23,020,397 (GRCm39) missense probably benign 0.03
R1269:Nlrp4e UTSW 7 23,052,763 (GRCm39) missense possibly damaging 0.95
R1400:Nlrp4e UTSW 7 23,021,085 (GRCm39) missense possibly damaging 0.93
R1497:Nlrp4e UTSW 7 23,019,797 (GRCm39) missense probably benign 0.00
R1518:Nlrp4e UTSW 7 23,021,268 (GRCm39) missense probably benign 0.33
R1716:Nlrp4e UTSW 7 23,020,458 (GRCm39) missense possibly damaging 0.56
R1727:Nlrp4e UTSW 7 23,020,420 (GRCm39) missense probably benign 0.01
R1998:Nlrp4e UTSW 7 23,020,671 (GRCm39) missense probably benign 0.00
R2177:Nlrp4e UTSW 7 23,054,686 (GRCm39) missense probably benign 0.00
R3724:Nlrp4e UTSW 7 23,020,802 (GRCm39) missense probably benign 0.28
R3767:Nlrp4e UTSW 7 23,039,988 (GRCm39) missense probably damaging 1.00
R3795:Nlrp4e UTSW 7 23,020,228 (GRCm39) missense probably benign 0.35
R4387:Nlrp4e UTSW 7 23,020,652 (GRCm39) missense probably benign 0.01
R4387:Nlrp4e UTSW 7 23,000,902 (GRCm39) missense probably benign 0.00
R4388:Nlrp4e UTSW 7 23,020,652 (GRCm39) missense probably benign 0.01
R4388:Nlrp4e UTSW 7 23,000,902 (GRCm39) missense probably benign 0.00
R4389:Nlrp4e UTSW 7 23,020,652 (GRCm39) missense probably benign 0.01
R4403:Nlrp4e UTSW 7 23,020,888 (GRCm39) nonsense probably null
R4444:Nlrp4e UTSW 7 23,020,652 (GRCm39) missense probably benign 0.01
R4486:Nlrp4e UTSW 7 23,020,652 (GRCm39) missense probably benign 0.01
R4547:Nlrp4e UTSW 7 23,036,291 (GRCm39) missense probably benign 0.00
R4553:Nlrp4e UTSW 7 23,020,404 (GRCm39) missense probably benign
R4666:Nlrp4e UTSW 7 23,036,205 (GRCm39) nonsense probably null
R4721:Nlrp4e UTSW 7 23,020,521 (GRCm39) missense possibly damaging 0.84
R4728:Nlrp4e UTSW 7 23,020,989 (GRCm39) missense probably benign
R4758:Nlrp4e UTSW 7 23,020,043 (GRCm39) missense probably benign 0.17
R4775:Nlrp4e UTSW 7 23,042,525 (GRCm39) missense probably benign 0.14
R4830:Nlrp4e UTSW 7 23,036,165 (GRCm39) missense probably benign 0.03
R4954:Nlrp4e UTSW 7 23,061,318 (GRCm39) nonsense probably null
R5277:Nlrp4e UTSW 7 23,020,863 (GRCm39) missense probably benign 0.02
R5352:Nlrp4e UTSW 7 23,052,598 (GRCm39) missense probably benign 0.26
R5521:Nlrp4e UTSW 7 23,021,190 (GRCm39) missense probably benign 0.00
R5537:Nlrp4e UTSW 7 23,019,914 (GRCm39) missense probably benign 0.00
R5584:Nlrp4e UTSW 7 23,020,602 (GRCm39) missense probably benign
R5683:Nlrp4e UTSW 7 23,052,697 (GRCm39) missense probably damaging 0.99
R6160:Nlrp4e UTSW 7 23,020,731 (GRCm39) missense probably damaging 0.99
R6313:Nlrp4e UTSW 7 23,052,597 (GRCm39) missense probably benign
R6427:Nlrp4e UTSW 7 23,020,058 (GRCm39) missense possibly damaging 0.48
R6647:Nlrp4e UTSW 7 23,020,740 (GRCm39) missense probably benign 0.00
R6929:Nlrp4e UTSW 7 23,036,156 (GRCm39) critical splice acceptor site probably null
R7307:Nlrp4e UTSW 7 23,020,953 (GRCm39) missense probably benign 0.07
R7792:Nlrp4e UTSW 7 23,021,182 (GRCm39) missense possibly damaging 0.60
R8169:Nlrp4e UTSW 7 23,019,931 (GRCm39) missense probably benign 0.06
R8445:Nlrp4e UTSW 7 23,039,965 (GRCm39) missense probably benign 0.00
R8487:Nlrp4e UTSW 7 23,020,983 (GRCm39) missense probably benign 0.00
R8906:Nlrp4e UTSW 7 23,020,556 (GRCm39) missense possibly damaging 0.88
R9124:Nlrp4e UTSW 7 23,020,403 (GRCm39) missense probably benign
R9167:Nlrp4e UTSW 7 23,039,951 (GRCm39) missense probably benign 0.00
R9181:Nlrp4e UTSW 7 23,061,270 (GRCm39) nonsense probably null
R9219:Nlrp4e UTSW 7 23,020,941 (GRCm39) missense possibly damaging 0.50
R9229:Nlrp4e UTSW 7 23,020,799 (GRCm39) missense probably benign 0.00
R9321:Nlrp4e UTSW 7 23,020,755 (GRCm39) missense probably benign
R9323:Nlrp4e UTSW 7 23,020,755 (GRCm39) missense probably benign
R9325:Nlrp4e UTSW 7 23,020,755 (GRCm39) missense probably benign
R9379:Nlrp4e UTSW 7 23,020,755 (GRCm39) missense probably benign
R9380:Nlrp4e UTSW 7 23,020,755 (GRCm39) missense probably benign
R9448:Nlrp4e UTSW 7 23,000,956 (GRCm39) missense probably benign
R9523:Nlrp4e UTSW 7 23,054,636 (GRCm39) missense probably benign 0.00
R9593:Nlrp4e UTSW 7 23,020,197 (GRCm39) missense probably benign 0.19
X0022:Nlrp4e UTSW 7 23,042,544 (GRCm39) missense probably damaging 1.00
X0025:Nlrp4e UTSW 7 23,042,603 (GRCm39) missense possibly damaging 0.91
X0026:Nlrp4e UTSW 7 23,054,648 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CCGCTCTTTGTTCTACAGGG -3'
(R):5'- GATCAGTTCTTAAAGTGAGGAAGTC -3'

Sequencing Primer
(F):5'- CTACAGGGTAAATAATGTGACTTTGC -3'
(R):5'- AGTAAGACCCCATCCATTGTGGG -3'
Posted On 2016-10-06