Incidental Mutation 'R5528:Mkrn3'
ID 433528
Institutional Source Beutler Lab
Gene Symbol Mkrn3
Ensembl Gene ENSMUSG00000070527
Gene Name makorin, ring finger protein, 3
Synonyms D7H15S9-1, Zfp127
MMRRC Submission 043086-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5528 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 62067341-62069887 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 62068735 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 352 (E352G)
Ref Sequence ENSEMBL: ENSMUSP00000091898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094340]
AlphaFold Q60764
Predicted Effect possibly damaging
Transcript: ENSMUST00000094340
AA Change: E352G

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091898
Gene: ENSMUSG00000070527
AA Change: E352G

DomainStartEndE-ValueType
low complexity region 9 25 N/A INTRINSIC
low complexity region 36 46 N/A INTRINSIC
ZnF_C3H1 92 118 7.31e-8 SMART
low complexity region 156 172 N/A INTRINSIC
low complexity region 205 220 N/A INTRINSIC
ZnF_C3H1 275 300 3.95e-4 SMART
RING 347 400 5.14e-7 SMART
low complexity region 415 422 N/A INTRINSIC
ZnF_C3H1 432 458 1.16e-1 SMART
Pfam:MKRN1_C 467 542 1.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207232
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING (C3HC4) zinc finger motif and several C3H zinc finger motifs. This gene is intronless and imprinted, with expression only from the paternal allele. Disruption of the imprinting at this locus may contribute to Prader-Willi syndrome. An antisense RNA of unknown function has been found overlapping this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 137,772,260 (GRCm39) L483P probably benign Het
4930519G04Rik T G 5: 115,012,415 (GRCm39) probably null Het
Ablim2 C T 5: 36,013,510 (GRCm39) Q148* probably null Het
Ap3s2 A T 7: 79,530,234 (GRCm39) *194R probably null Het
Arpp21 C T 9: 111,978,421 (GRCm39) A235T probably benign Het
C9orf72 T C 4: 35,213,556 (GRCm39) D198G probably benign Het
Ccdc33 T C 9: 57,936,078 (GRCm39) D939G probably benign Het
Celsr2 A T 3: 108,320,610 (GRCm39) I734N probably damaging Het
Clcn1 C A 6: 42,277,275 (GRCm39) N455K probably benign Het
Cpne8 C T 15: 90,503,893 (GRCm39) V91I possibly damaging Het
Cstdc7 A G 18: 42,306,727 (GRCm39) probably null Het
Ddx1 A G 12: 13,279,295 (GRCm39) V448A probably damaging Het
Dnhd1 G A 7: 105,352,416 (GRCm39) R2523Q probably damaging Het
Eeig1 G A 2: 32,456,339 (GRCm39) A334T probably damaging Het
Eif2a G T 3: 58,455,933 (GRCm39) D311Y probably damaging Het
Eif2ak4 G A 2: 118,258,419 (GRCm39) E512K probably damaging Het
Esp15 A T 17: 39,955,640 (GRCm39) Y69F probably benign Het
Gucy1a1 A T 3: 82,016,380 (GRCm39) Y203N probably damaging Het
Hook3 T C 8: 26,562,321 (GRCm39) Q248R probably damaging Het
Ifit2 T A 19: 34,550,937 (GRCm39) V159E possibly damaging Het
Il17rd T C 14: 26,810,024 (GRCm39) V20A possibly damaging Het
Kcnq3 T A 15: 65,897,027 (GRCm39) D291V probably damaging Het
Klf11 A T 12: 24,704,929 (GRCm39) M111L probably benign Het
Lama5 T A 2: 179,836,356 (GRCm39) H1165L probably benign Het
Lmo7 A G 14: 102,139,522 (GRCm39) N702S probably damaging Het
Lta4h T C 10: 93,307,736 (GRCm39) V323A probably damaging Het
Ms4a19 T C 19: 11,118,999 (GRCm39) S37G possibly damaging Het
Mtf2 T A 5: 108,242,023 (GRCm39) L277Q probably damaging Het
Myo9b A G 8: 71,775,918 (GRCm39) N370D probably benign Het
Nlrp4e A C 7: 23,036,316 (GRCm39) K723T probably benign Het
Nsun3 A G 16: 62,555,689 (GRCm39) V279A possibly damaging Het
Pde6b A G 5: 108,571,424 (GRCm39) D459G probably benign Het
Phgdh T C 3: 98,235,655 (GRCm39) I121V probably benign Het
Pik3r5 T C 11: 68,386,803 (GRCm39) C811R probably damaging Het
Spaca6 A C 17: 18,051,344 (GRCm39) I27L probably benign Het
Trmt1l G A 1: 151,330,746 (GRCm39) V588I probably benign Het
Tshr A G 12: 91,503,967 (GRCm39) N302D probably damaging Het
Vmn2r23 A G 6: 123,689,961 (GRCm39) D279G probably damaging Het
Wnt3a T C 11: 59,166,106 (GRCm39) N58S probably damaging Het
Zkscan8 A G 13: 21,704,895 (GRCm39) V276A probably damaging Het
Other mutations in Mkrn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0558:Mkrn3 UTSW 7 62,068,612 (GRCm39) missense probably benign 0.29
R1885:Mkrn3 UTSW 7 62,068,486 (GRCm39) missense probably benign 0.09
R1886:Mkrn3 UTSW 7 62,068,486 (GRCm39) missense probably benign 0.09
R2904:Mkrn3 UTSW 7 62,068,207 (GRCm39) missense probably benign 0.38
R3117:Mkrn3 UTSW 7 62,068,962 (GRCm39) small deletion probably benign
R3118:Mkrn3 UTSW 7 62,068,962 (GRCm39) small deletion probably benign
R4593:Mkrn3 UTSW 7 62,068,552 (GRCm39) nonsense probably null
R4654:Mkrn3 UTSW 7 62,069,452 (GRCm39) missense probably damaging 1.00
R4735:Mkrn3 UTSW 7 62,069,452 (GRCm39) missense probably damaging 1.00
R5932:Mkrn3 UTSW 7 62,068,655 (GRCm39) missense probably damaging 1.00
R5950:Mkrn3 UTSW 7 62,069,467 (GRCm39) missense probably damaging 1.00
R6120:Mkrn3 UTSW 7 62,069,282 (GRCm39) missense probably benign 0.00
R6618:Mkrn3 UTSW 7 62,068,781 (GRCm39) missense probably benign 0.25
R6951:Mkrn3 UTSW 7 62,068,881 (GRCm39) missense possibly damaging 0.68
R7009:Mkrn3 UTSW 7 62,069,366 (GRCm39) missense probably benign 0.05
R7227:Mkrn3 UTSW 7 62,069,415 (GRCm39) missense probably benign 0.03
R7228:Mkrn3 UTSW 7 62,069,415 (GRCm39) missense probably benign 0.03
R7286:Mkrn3 UTSW 7 62,068,675 (GRCm39) missense probably benign 0.15
R7339:Mkrn3 UTSW 7 62,069,530 (GRCm39) missense probably benign 0.22
R8268:Mkrn3 UTSW 7 62,068,270 (GRCm39) missense probably damaging 1.00
R8366:Mkrn3 UTSW 7 62,069,543 (GRCm39) missense probably benign 0.21
R9390:Mkrn3 UTSW 7 62,069,288 (GRCm39) missense probably benign 0.17
X0025:Mkrn3 UTSW 7 62,069,521 (GRCm39) missense probably damaging 1.00
Z1176:Mkrn3 UTSW 7 62,069,558 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCACTAGGAATGACAAAGCCAG -3'
(R):5'- TGTTCCTGGACAGCCTTACC -3'

Sequencing Primer
(F):5'- AGAGGAGACCCTGCACTGTG -3'
(R):5'- TGCCAGTGCCAATGCCAATG -3'
Posted On 2016-10-06