Incidental Mutation 'R5528:Mkrn3'
ID433528
Institutional Source Beutler Lab
Gene Symbol Mkrn3
Ensembl Gene ENSMUSG00000070527
Gene Namemakorin, ring finger protein, 3
SynonymsZfp127, D7H15S9-1
MMRRC Submission 043086-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5528 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location62417593-62420139 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62418987 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 352 (E352G)
Ref Sequence ENSEMBL: ENSMUSP00000091898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094340]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094340
AA Change: E352G

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091898
Gene: ENSMUSG00000070527
AA Change: E352G

DomainStartEndE-ValueType
low complexity region 9 25 N/A INTRINSIC
low complexity region 36 46 N/A INTRINSIC
ZnF_C3H1 92 118 7.31e-8 SMART
low complexity region 156 172 N/A INTRINSIC
low complexity region 205 220 N/A INTRINSIC
ZnF_C3H1 275 300 3.95e-4 SMART
RING 347 400 5.14e-7 SMART
low complexity region 415 422 N/A INTRINSIC
ZnF_C3H1 432 458 1.16e-1 SMART
Pfam:MKRN1_C 467 542 1.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207232
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING (C3HC4) zinc finger motif and several C3H zinc finger motifs. This gene is intronless and imprinted, with expression only from the paternal allele. Disruption of the imprinting at this locus may contribute to Prader-Willi syndrome. An antisense RNA of unknown function has been found overlapping this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,066,499 L483P probably benign Het
1700025F22Rik T C 19: 11,141,635 S37G possibly damaging Het
3110043O21Rik T C 4: 35,213,556 D198G probably benign Het
4930519G04Rik T G 5: 114,874,354 probably null Het
Ablim2 C T 5: 35,856,166 Q148* probably null Het
Ap3s2 A T 7: 79,880,486 *194R probably null Het
Arpp21 C T 9: 112,149,353 A235T probably benign Het
Ccdc33 T C 9: 58,028,795 D939G probably benign Het
Celsr2 A T 3: 108,413,294 I734N probably damaging Het
Clcn1 C A 6: 42,300,341 N455K probably benign Het
Cpne8 C T 15: 90,619,690 V91I possibly damaging Het
Ddx1 A G 12: 13,229,294 V448A probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Eif2a G T 3: 58,548,512 D311Y probably damaging Het
Eif2ak4 G A 2: 118,427,938 E512K probably damaging Het
Esp15 A T 17: 39,644,749 Y69F probably benign Het
Fam102a G A 2: 32,566,327 A334T probably damaging Het
Gm5689 A G 18: 42,173,662 probably null Het
Gucy1a1 A T 3: 82,109,073 Y203N probably damaging Het
Hook3 T C 8: 26,072,293 Q248R probably damaging Het
Ifit2 T A 19: 34,573,537 V159E possibly damaging Het
Il17rd T C 14: 27,088,067 V20A possibly damaging Het
Kcnq3 T A 15: 66,025,178 D291V probably damaging Het
Klf11 A T 12: 24,654,930 M111L probably benign Het
Lama5 T A 2: 180,194,563 H1165L probably benign Het
Lmo7 A G 14: 101,902,086 N702S probably damaging Het
Lta4h T C 10: 93,471,874 V323A probably damaging Het
Mtf2 T A 5: 108,094,157 L277Q probably damaging Het
Myo9b A G 8: 71,323,274 N370D probably benign Het
Nlrp4e A C 7: 23,336,891 K723T probably benign Het
Nsun3 A G 16: 62,735,326 V279A possibly damaging Het
Pde6b A G 5: 108,423,558 D459G probably benign Het
Phgdh T C 3: 98,328,339 I121V probably benign Het
Pik3r5 T C 11: 68,495,977 C811R probably damaging Het
Spaca6 A C 17: 17,831,082 I27L probably benign Het
Trmt1l G A 1: 151,454,995 V588I probably benign Het
Tshr A G 12: 91,537,193 N302D probably damaging Het
Vmn2r23 A G 6: 123,713,002 D279G probably damaging Het
Wnt3a T C 11: 59,275,280 N58S probably damaging Het
Zkscan8 A G 13: 21,520,725 V276A probably damaging Het
Other mutations in Mkrn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0558:Mkrn3 UTSW 7 62418864 missense probably benign 0.29
R1885:Mkrn3 UTSW 7 62418738 missense probably benign 0.09
R1886:Mkrn3 UTSW 7 62418738 missense probably benign 0.09
R2904:Mkrn3 UTSW 7 62418459 missense probably benign 0.38
R3117:Mkrn3 UTSW 7 62419214 small deletion probably benign
R3118:Mkrn3 UTSW 7 62419214 small deletion probably benign
R4593:Mkrn3 UTSW 7 62418804 nonsense probably null
R4654:Mkrn3 UTSW 7 62419704 missense probably damaging 1.00
R4735:Mkrn3 UTSW 7 62419704 missense probably damaging 1.00
R5932:Mkrn3 UTSW 7 62418907 missense probably damaging 1.00
R5950:Mkrn3 UTSW 7 62419719 missense probably damaging 1.00
R6120:Mkrn3 UTSW 7 62419534 missense probably benign 0.00
R6618:Mkrn3 UTSW 7 62419033 missense probably benign 0.25
R6951:Mkrn3 UTSW 7 62419133 missense possibly damaging 0.68
R7009:Mkrn3 UTSW 7 62419618 missense probably benign 0.05
R7227:Mkrn3 UTSW 7 62419667 missense probably benign 0.03
R7228:Mkrn3 UTSW 7 62419667 missense probably benign 0.03
R7286:Mkrn3 UTSW 7 62418927 missense probably benign 0.15
R7339:Mkrn3 UTSW 7 62419782 missense probably benign 0.22
R8268:Mkrn3 UTSW 7 62418522 missense probably damaging 1.00
R8366:Mkrn3 UTSW 7 62419795 missense probably benign 0.21
X0025:Mkrn3 UTSW 7 62419773 missense probably damaging 1.00
Z1176:Mkrn3 UTSW 7 62419810 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCACTAGGAATGACAAAGCCAG -3'
(R):5'- TGTTCCTGGACAGCCTTACC -3'

Sequencing Primer
(F):5'- AGAGGAGACCCTGCACTGTG -3'
(R):5'- TGCCAGTGCCAATGCCAATG -3'
Posted On2016-10-06