Mutagenetix > Incidental Mutation

Incidental Mutation 'R5528:Hook3'

433532

Institutional Source

Beutler Lab

Gene Symbol

Hook3

Ensembl Gene

ENSMUSG00000037234

Gene Name

hook microtubule tethering protein 3

Synonyms

E330005F07Rik, 5830454D03Rik

MMRRC Submission

043086-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5528 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

26021421-26119224 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 26072293 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 248 (Q248R)

Ref Sequence

ENSEMBL: ENSMUSP00000046788 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037182] [ENSMUST00000147613]

AlphaFold

Q8BUK6

Predicted Effect

probably damaging
Transcript: ENSMUST00000037182
AA Change: Q248R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000046788
Gene: ENSMUSG00000037234
AA Change: Q248R

Domain	Start	End	E-Value	Type
Pfam:HOOK	12	710	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000147613

SMART Domains

Protein: ENSMUSP00000115008
Gene: ENSMUSG00000037234

Domain	Start	End	E-Value	Type
Pfam:HOOK	1	194	1.1e-75	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209996

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210172

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210860

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211292

Coding Region Coverage

1x: 98.6%
3x: 97.4%
10x: 95.4%
20x: 91.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	C	3: 138,066,499	L483P	probably benign	Het
1700025F22Rik	T	C	19: 11,141,635	S37G	possibly damaging	Het
3110043O21Rik	T	C	4: 35,213,556	D198G	probably benign	Het
4930519G04Rik	T	G	5: 114,874,354		probably null	Het
Ablim2	C	T	5: 35,856,166	Q148*	probably null	Het
Ap3s2	A	T	7: 79,880,486	*194R	probably null	Het
Arpp21	C	T	9: 112,149,353	A235T	probably benign	Het
Ccdc33	T	C	9: 58,028,795	D939G	probably benign	Het
Celsr2	A	T	3: 108,413,294	I734N	probably damaging	Het
Clcn1	C	A	6: 42,300,341	N455K	probably benign	Het
Cpne8	C	T	15: 90,619,690	V91I	possibly damaging	Het
Ddx1	A	G	12: 13,229,294	V448A	probably damaging	Het
Dnhd1	G	A	7: 105,703,209	R2523Q	probably damaging	Het
Eif2a	G	T	3: 58,548,512	D311Y	probably damaging	Het
Eif2ak4	G	A	2: 118,427,938	E512K	probably damaging	Het
Esp15	A	T	17: 39,644,749	Y69F	probably benign	Het
Fam102a	G	A	2: 32,566,327	A334T	probably damaging	Het
Gm5689	A	G	18: 42,173,662		probably null	Het
Gucy1a1	A	T	3: 82,109,073	Y203N	probably damaging	Het
Ifit2	T	A	19: 34,573,537	V159E	possibly damaging	Het
Il17rd	T	C	14: 27,088,067	V20A	possibly damaging	Het
Kcnq3	T	A	15: 66,025,178	D291V	probably damaging	Het
Klf11	A	T	12: 24,654,930	M111L	probably benign	Het
Lama5	T	A	2: 180,194,563	H1165L	probably benign	Het
Lmo7	A	G	14: 101,902,086	N702S	probably damaging	Het
Lta4h	T	C	10: 93,471,874	V323A	probably damaging	Het
Mkrn3	T	C	7: 62,418,987	E352G	possibly damaging	Het
Mtf2	T	A	5: 108,094,157	L277Q	probably damaging	Het
Myo9b	A	G	8: 71,323,274	N370D	probably benign	Het
Nlrp4e	A	C	7: 23,336,891	K723T	probably benign	Het
Nsun3	A	G	16: 62,735,326	V279A	possibly damaging	Het
Pde6b	A	G	5: 108,423,558	D459G	probably benign	Het
Phgdh	T	C	3: 98,328,339	I121V	probably benign	Het
Pik3r5	T	C	11: 68,495,977	C811R	probably damaging	Het
Spaca6	A	C	17: 17,831,082	I27L	probably benign	Het
Trmt1l	G	A	1: 151,454,995	V588I	probably benign	Het
Tshr	A	G	12: 91,537,193	N302D	probably damaging	Het
Vmn2r23	A	G	6: 123,713,002	D279G	probably damaging	Het
Wnt3a	T	C	11: 59,275,280	N58S	probably damaging	Het
Zkscan8	A	G	13: 21,520,725	V276A	probably damaging	Het

Other mutations in Hook3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00695:Hook3	APN	8	26059250	missense	possibly damaging	0.46
IGL01066:Hook3	APN	8	26048298	missense	probably damaging	1.00
IGL01145:Hook3	APN	8	26059344	missense	probably benign	0.00
IGL01514:Hook3	APN	8	26088189	missense	possibly damaging	0.69
IGL01727:Hook3	APN	8	26070159	missense	probably benign	0.00
IGL01832:Hook3	APN	8	26072365	missense	possibly damaging	0.87
IGL01874:Hook3	APN	8	26039732	missense	possibly damaging	0.71
IGL01931:Hook3	APN	8	26088055	splice site	probably benign
IGL01948:Hook3	APN	8	26059312	missense	possibly damaging	0.95
IGL02209:Hook3	APN	8	26070265	missense	probably damaging	0.99
IGL02675:Hook3	APN	8	26061434	missense	possibly damaging	0.64
IGL02750:Hook3	APN	8	26095754	splice site	probably benign
Rufio	UTSW	8	26034940	nonsense	probably null
R0384:Hook3	UTSW	8	26044235	splice site	probably null
R0600:Hook3	UTSW	8	26118986	missense	probably benign
R1037:Hook3	UTSW	8	26072350	missense	possibly damaging	0.92
R1413:Hook3	UTSW	8	26038106	missense	probably damaging	0.98
R1563:Hook3	UTSW	8	26110752	missense	probably benign	0.06
R1767:Hook3	UTSW	8	26071056	critical splice donor site	probably null
R1806:Hook3	UTSW	8	26068659	missense	probably damaging	1.00
R2025:Hook3	UTSW	8	26038098	missense	probably damaging	0.96
R2026:Hook3	UTSW	8	26038098	missense	probably damaging	0.96
R2027:Hook3	UTSW	8	26038098	missense	probably damaging	0.96
R2091:Hook3	UTSW	8	26059394	splice site	probably benign
R2153:Hook3	UTSW	8	26070197	missense	probably damaging	1.00
R2184:Hook3	UTSW	8	26118983	missense	probably benign	0.00
R4586:Hook3	UTSW	8	26032011	missense	probably damaging	0.98
R4863:Hook3	UTSW	8	26038029	missense	probably damaging	1.00
R4971:Hook3	UTSW	8	26082579	missense	probably benign	0.22
R5023:Hook3	UTSW	8	26032019	frame shift	probably null
R5026:Hook3	UTSW	8	26110757	missense	probably damaging	0.98
R5068:Hook3	UTSW	8	26095757	critical splice donor site	probably null
R5253:Hook3	UTSW	8	26072291	missense	probably benign
R5383:Hook3	UTSW	8	26118989	missense	probably benign	0.01
R5437:Hook3	UTSW	8	26061422	missense	probably benign	0.05
R5551:Hook3	UTSW	8	26068611	missense	possibly damaging	0.75
R5846:Hook3	UTSW	8	26044327	intron	probably benign
R5907:Hook3	UTSW	8	26044278	intron	probably benign
R6082:Hook3	UTSW	8	26110785	missense	probably benign	0.00
R6124:Hook3	UTSW	8	26059272	missense	probably benign	0.20
R6301:Hook3	UTSW	8	26034940	nonsense	probably null
R6314:Hook3	UTSW	8	26088108	missense	probably benign
R6448:Hook3	UTSW	8	26093664	missense	probably benign	0.02
R6810:Hook3	UTSW	8	26032422	splice site	probably null
R7168:Hook3	UTSW	8	26071086	missense	probably benign	0.02
R7856:Hook3	UTSW	8	26035221	missense	probably damaging	1.00
R7988:Hook3	UTSW	8	26073647	missense	probably benign	0.02
R8079:Hook3	UTSW	8	26088058	critical splice donor site	probably null
R9121:Hook3	UTSW	8	26035167	missense	probably damaging	1.00
R9223:Hook3	UTSW	8	26032524	missense
R9244:Hook3	UTSW	8	26071056	critical splice donor site	probably null
R9246:Hook3	UTSW	8	26072291	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGTCTATCTGTGTGCGTCAG -3'
(R):5'- TCACAAGAGTTTGAGTTGGATAACC -3'

Sequencing Primer
(F):5'- GCGTCAGAGTTAGCTAATATCTGC -3'
(R):5'- TGAGTTGGATAACCACAGTCC -3'

Posted On

2016-10-06