Incidental Mutation 'R5528:Ccdc33'
ID 433535
Institutional Source Beutler Lab
Gene Symbol Ccdc33
Ensembl Gene ENSMUSG00000037716
Gene Name coiled-coil domain containing 33
Synonyms LOC382077, 4930535E21Rik
MMRRC Submission 043086-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5528 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 57935960-58026106 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57936078 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 939 (D939G)
Ref Sequence ENSEMBL: ENSMUSP00000149337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034874] [ENSMUST00000042205] [ENSMUST00000098682] [ENSMUST00000119665] [ENSMUST00000215944] [ENSMUST00000188539]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000034874
SMART Domains Protein: ENSMUSP00000034874
Gene: ENSMUSG00000032323

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
Pfam:p450 49 507 1.8e-120 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000042205
AA Change: D720G
SMART Domains Protein: ENSMUSP00000040899
Gene: ENSMUSG00000037716
AA Change: D720G

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 451 N/A INTRINSIC
coiled coil region 472 560 N/A INTRINSIC
coiled coil region 630 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098682
AA Change: D974G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096279
Gene: ENSMUSG00000037716
AA Change: D974G

DomainStartEndE-ValueType
C2 281 385 5.79e-3 SMART
coiled coil region 598 636 N/A INTRINSIC
coiled coil region 657 745 N/A INTRINSIC
coiled coil region 884 922 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000119665
AA Change: D719G
SMART Domains Protein: ENSMUSP00000112613
Gene: ENSMUSG00000037716
AA Change: D719G

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 559 N/A INTRINSIC
coiled coil region 629 667 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153106
Predicted Effect probably benign
Transcript: ENSMUST00000215944
AA Change: D939G

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000188539
SMART Domains Protein: ENSMUSP00000140777
Gene: ENSMUSG00000032323

DomainStartEndE-ValueType
Pfam:p450 23 279 2.6e-51 PFAM
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 137,772,260 (GRCm39) L483P probably benign Het
4930519G04Rik T G 5: 115,012,415 (GRCm39) probably null Het
Ablim2 C T 5: 36,013,510 (GRCm39) Q148* probably null Het
Ap3s2 A T 7: 79,530,234 (GRCm39) *194R probably null Het
Arpp21 C T 9: 111,978,421 (GRCm39) A235T probably benign Het
C9orf72 T C 4: 35,213,556 (GRCm39) D198G probably benign Het
Celsr2 A T 3: 108,320,610 (GRCm39) I734N probably damaging Het
Clcn1 C A 6: 42,277,275 (GRCm39) N455K probably benign Het
Cpne8 C T 15: 90,503,893 (GRCm39) V91I possibly damaging Het
Cstdc7 A G 18: 42,306,727 (GRCm39) probably null Het
Ddx1 A G 12: 13,279,295 (GRCm39) V448A probably damaging Het
Dnhd1 G A 7: 105,352,416 (GRCm39) R2523Q probably damaging Het
Eeig1 G A 2: 32,456,339 (GRCm39) A334T probably damaging Het
Eif2a G T 3: 58,455,933 (GRCm39) D311Y probably damaging Het
Eif2ak4 G A 2: 118,258,419 (GRCm39) E512K probably damaging Het
Esp15 A T 17: 39,955,640 (GRCm39) Y69F probably benign Het
Gucy1a1 A T 3: 82,016,380 (GRCm39) Y203N probably damaging Het
Hook3 T C 8: 26,562,321 (GRCm39) Q248R probably damaging Het
Ifit2 T A 19: 34,550,937 (GRCm39) V159E possibly damaging Het
Il17rd T C 14: 26,810,024 (GRCm39) V20A possibly damaging Het
Kcnq3 T A 15: 65,897,027 (GRCm39) D291V probably damaging Het
Klf11 A T 12: 24,704,929 (GRCm39) M111L probably benign Het
Lama5 T A 2: 179,836,356 (GRCm39) H1165L probably benign Het
Lmo7 A G 14: 102,139,522 (GRCm39) N702S probably damaging Het
Lta4h T C 10: 93,307,736 (GRCm39) V323A probably damaging Het
Mkrn3 T C 7: 62,068,735 (GRCm39) E352G possibly damaging Het
Ms4a19 T C 19: 11,118,999 (GRCm39) S37G possibly damaging Het
Mtf2 T A 5: 108,242,023 (GRCm39) L277Q probably damaging Het
Myo9b A G 8: 71,775,918 (GRCm39) N370D probably benign Het
Nlrp4e A C 7: 23,036,316 (GRCm39) K723T probably benign Het
Nsun3 A G 16: 62,555,689 (GRCm39) V279A possibly damaging Het
Pde6b A G 5: 108,571,424 (GRCm39) D459G probably benign Het
Phgdh T C 3: 98,235,655 (GRCm39) I121V probably benign Het
Pik3r5 T C 11: 68,386,803 (GRCm39) C811R probably damaging Het
Spaca6 A C 17: 18,051,344 (GRCm39) I27L probably benign Het
Trmt1l G A 1: 151,330,746 (GRCm39) V588I probably benign Het
Tshr A G 12: 91,503,967 (GRCm39) N302D probably damaging Het
Vmn2r23 A G 6: 123,689,961 (GRCm39) D279G probably damaging Het
Wnt3a T C 11: 59,166,106 (GRCm39) N58S probably damaging Het
Zkscan8 A G 13: 21,704,895 (GRCm39) V276A probably damaging Het
Other mutations in Ccdc33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Ccdc33 APN 9 57,977,257 (GRCm39) splice site probably benign
IGL01403:Ccdc33 APN 9 58,024,668 (GRCm39) missense probably damaging 1.00
IGL01411:Ccdc33 APN 9 58,024,919 (GRCm39) splice site probably benign
IGL01714:Ccdc33 APN 9 57,937,153 (GRCm39) missense possibly damaging 0.91
IGL02028:Ccdc33 APN 9 57,983,861 (GRCm39) missense probably benign 0.13
IGL02158:Ccdc33 APN 9 57,937,702 (GRCm39) missense probably damaging 0.99
IGL02174:Ccdc33 APN 9 57,940,938 (GRCm39) missense probably benign 0.45
IGL02805:Ccdc33 APN 9 58,005,874 (GRCm39) missense probably benign 0.43
R0276:Ccdc33 UTSW 9 57,965,675 (GRCm39) missense probably damaging 0.99
R0537:Ccdc33 UTSW 9 58,024,737 (GRCm39) missense probably damaging 1.00
R0737:Ccdc33 UTSW 9 57,989,331 (GRCm39) missense probably damaging 0.99
R0789:Ccdc33 UTSW 9 58,024,497 (GRCm39) splice site probably benign
R0791:Ccdc33 UTSW 9 57,936,046 (GRCm39) missense possibly damaging 0.66
R0920:Ccdc33 UTSW 9 57,940,955 (GRCm39) missense probably damaging 0.99
R1541:Ccdc33 UTSW 9 58,024,749 (GRCm39) missense probably damaging 0.99
R1759:Ccdc33 UTSW 9 58,024,729 (GRCm39) missense possibly damaging 0.84
R1857:Ccdc33 UTSW 9 57,939,991 (GRCm39) missense possibly damaging 0.66
R1976:Ccdc33 UTSW 9 58,024,445 (GRCm39) nonsense probably null
R1982:Ccdc33 UTSW 9 58,024,451 (GRCm39) missense probably benign 0.07
R2044:Ccdc33 UTSW 9 57,938,395 (GRCm39) missense possibly damaging 0.93
R2224:Ccdc33 UTSW 9 57,989,305 (GRCm39) missense probably damaging 1.00
R2225:Ccdc33 UTSW 9 57,989,305 (GRCm39) missense probably damaging 1.00
R2227:Ccdc33 UTSW 9 57,989,305 (GRCm39) missense probably damaging 1.00
R2369:Ccdc33 UTSW 9 57,983,913 (GRCm39) missense probably benign 0.44
R3899:Ccdc33 UTSW 9 57,940,200 (GRCm39) missense probably damaging 0.99
R4468:Ccdc33 UTSW 9 57,977,155 (GRCm39) missense possibly damaging 0.67
R4468:Ccdc33 UTSW 9 57,937,235 (GRCm39) missense possibly damaging 0.93
R4703:Ccdc33 UTSW 9 57,940,953 (GRCm39) missense possibly damaging 0.86
R4705:Ccdc33 UTSW 9 58,024,840 (GRCm39) missense probably benign 0.01
R4790:Ccdc33 UTSW 9 57,937,240 (GRCm39) missense probably damaging 0.96
R4817:Ccdc33 UTSW 9 57,974,818 (GRCm39) missense probably damaging 0.98
R4879:Ccdc33 UTSW 9 57,974,839 (GRCm39) missense possibly damaging 0.86
R4931:Ccdc33 UTSW 9 57,977,134 (GRCm39) missense probably damaging 1.00
R5015:Ccdc33 UTSW 9 58,025,918 (GRCm39) missense probably damaging 1.00
R5223:Ccdc33 UTSW 9 57,940,267 (GRCm39) missense possibly damaging 0.91
R5327:Ccdc33 UTSW 9 57,993,860 (GRCm39) missense probably benign 0.00
R5534:Ccdc33 UTSW 9 58,024,450 (GRCm39) missense possibly damaging 0.83
R5786:Ccdc33 UTSW 9 57,937,235 (GRCm39) missense possibly damaging 0.93
R5844:Ccdc33 UTSW 9 57,940,489 (GRCm39) splice site probably benign
R5975:Ccdc33 UTSW 9 58,024,761 (GRCm39) missense possibly damaging 0.49
R6120:Ccdc33 UTSW 9 57,993,883 (GRCm39) missense probably damaging 1.00
R6256:Ccdc33 UTSW 9 58,009,201 (GRCm39) splice site probably null
R6363:Ccdc33 UTSW 9 58,021,618 (GRCm39) missense probably benign 0.00
R6610:Ccdc33 UTSW 9 57,976,419 (GRCm39) missense possibly damaging 0.66
R6767:Ccdc33 UTSW 9 57,940,527 (GRCm39) missense possibly damaging 0.96
R7072:Ccdc33 UTSW 9 58,019,267 (GRCm39) makesense probably null
R7121:Ccdc33 UTSW 9 57,988,167 (GRCm39) missense probably benign 0.00
R7182:Ccdc33 UTSW 9 57,941,456 (GRCm39) splice site probably null
R7239:Ccdc33 UTSW 9 57,940,192 (GRCm39) nonsense probably null
R7655:Ccdc33 UTSW 9 58,025,748 (GRCm39) missense probably damaging 0.97
R7656:Ccdc33 UTSW 9 58,025,748 (GRCm39) missense probably damaging 0.97
R7868:Ccdc33 UTSW 9 57,976,374 (GRCm39) missense probably benign
R8215:Ccdc33 UTSW 9 57,939,995 (GRCm39) missense probably benign 0.18
R9139:Ccdc33 UTSW 9 57,983,842 (GRCm39) missense probably benign 0.04
R9204:Ccdc33 UTSW 9 57,938,388 (GRCm39) missense probably benign 0.33
R9280:Ccdc33 UTSW 9 57,965,549 (GRCm39) missense probably benign
R9297:Ccdc33 UTSW 9 57,993,876 (GRCm39) missense possibly damaging 0.85
R9318:Ccdc33 UTSW 9 57,993,876 (GRCm39) missense possibly damaging 0.85
R9361:Ccdc33 UTSW 9 58,024,908 (GRCm39) missense possibly damaging 0.96
R9664:Ccdc33 UTSW 9 57,993,855 (GRCm39) missense possibly damaging 0.85
RF003:Ccdc33 UTSW 9 57,965,574 (GRCm39) missense probably benign 0.18
Z1176:Ccdc33 UTSW 9 58,024,699 (GRCm39) missense probably benign 0.01
Z1177:Ccdc33 UTSW 9 58,025,868 (GRCm39) missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GGACCCAAGTTGGATGTGAG -3'
(R):5'- GGGTTTTGAAGACTCAGGAGCC -3'

Sequencing Primer
(F):5'- TGAAGGTCCTGAGTTCAAATCCCAG -3'
(R):5'- CTGACTTGCCAGGTAAGATGC -3'
Posted On 2016-10-06