Incidental Mutation 'R5528:Lta4h'
ID433537
Institutional Source Beutler Lab
Gene Symbol Lta4h
Ensembl Gene ENSMUSG00000015889
Gene Nameleukotriene A4 hydrolase
SynonymsLTA4 hydrodase
MMRRC Submission 043086-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5528 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location93453411-93484875 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93471874 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 323 (V323A)
Ref Sequence ENSEMBL: ENSMUSP00000016033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016033]
Predicted Effect probably damaging
Transcript: ENSMUST00000016033
AA Change: V323A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016033
Gene: ENSMUSG00000015889
AA Change: V323A

DomainStartEndE-ValueType
Pfam:Peptidase_M1 13 387 7.8e-80 PFAM
Leuk-A4-hydro_C 464 608 2.01e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216931
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is an enzyme that contains both hydrolase and aminopeptidase activities. The hydrolase activity is used in the final step of the biosynthesis of leukotriene B4, a proinflammatory mediator. The aminopeptidase activity has been shown to degrade proline-glycine-proline (PGP), a neutrophil chemoattractant and biomarker for chronic obstructive pulmonary disease (COPD). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene have grossly normal phenotypes. Inflammatory reactions are reduced as are some other immunological responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,066,499 L483P probably benign Het
1700025F22Rik T C 19: 11,141,635 S37G possibly damaging Het
3110043O21Rik T C 4: 35,213,556 D198G probably benign Het
4930519G04Rik T G 5: 114,874,354 probably null Het
Ablim2 C T 5: 35,856,166 Q148* probably null Het
Ap3s2 A T 7: 79,880,486 *194R probably null Het
Arpp21 C T 9: 112,149,353 A235T probably benign Het
Ccdc33 T C 9: 58,028,795 D939G probably benign Het
Celsr2 A T 3: 108,413,294 I734N probably damaging Het
Clcn1 C A 6: 42,300,341 N455K probably benign Het
Cpne8 C T 15: 90,619,690 V91I possibly damaging Het
Ddx1 A G 12: 13,229,294 V448A probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Eif2a G T 3: 58,548,512 D311Y probably damaging Het
Eif2ak4 G A 2: 118,427,938 E512K probably damaging Het
Esp15 A T 17: 39,644,749 Y69F probably benign Het
Fam102a G A 2: 32,566,327 A334T probably damaging Het
Gm5689 A G 18: 42,173,662 probably null Het
Gucy1a1 A T 3: 82,109,073 Y203N probably damaging Het
Hook3 T C 8: 26,072,293 Q248R probably damaging Het
Ifit2 T A 19: 34,573,537 V159E possibly damaging Het
Il17rd T C 14: 27,088,067 V20A possibly damaging Het
Kcnq3 T A 15: 66,025,178 D291V probably damaging Het
Klf11 A T 12: 24,654,930 M111L probably benign Het
Lama5 T A 2: 180,194,563 H1165L probably benign Het
Lmo7 A G 14: 101,902,086 N702S probably damaging Het
Mkrn3 T C 7: 62,418,987 E352G possibly damaging Het
Mtf2 T A 5: 108,094,157 L277Q probably damaging Het
Myo9b A G 8: 71,323,274 N370D probably benign Het
Nlrp4e A C 7: 23,336,891 K723T probably benign Het
Nsun3 A G 16: 62,735,326 V279A possibly damaging Het
Pde6b A G 5: 108,423,558 D459G probably benign Het
Phgdh T C 3: 98,328,339 I121V probably benign Het
Pik3r5 T C 11: 68,495,977 C811R probably damaging Het
Spaca6 A C 17: 17,831,082 I27L probably benign Het
Trmt1l G A 1: 151,454,995 V588I probably benign Het
Tshr A G 12: 91,537,193 N302D probably damaging Het
Vmn2r23 A G 6: 123,713,002 D279G probably damaging Het
Wnt3a T C 11: 59,275,280 N58S probably damaging Het
Zkscan8 A G 13: 21,520,725 V276A probably damaging Het
Other mutations in Lta4h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01946:Lta4h APN 10 93471370 splice site probably benign
IGL02309:Lta4h APN 10 93474490 missense probably damaging 1.00
IGL02351:Lta4h APN 10 93478467 missense probably benign 0.28
IGL02358:Lta4h APN 10 93478467 missense probably benign 0.28
IGL02589:Lta4h APN 10 93474931 missense probably benign 0.01
IGL02649:Lta4h APN 10 93472969 missense probably benign 0.00
IGL03164:Lta4h APN 10 93470797 splice site probably benign
R0498:Lta4h UTSW 10 93471971 splice site probably benign
R1451:Lta4h UTSW 10 93480728 missense probably damaging 0.99
R1690:Lta4h UTSW 10 93484692 missense probably benign
R1837:Lta4h UTSW 10 93469175 missense probably damaging 1.00
R4202:Lta4h UTSW 10 93470807 missense probably damaging 1.00
R4684:Lta4h UTSW 10 93468816 missense probably benign
R5637:Lta4h UTSW 10 93468869 splice site probably null
R5873:Lta4h UTSW 10 93469190 critical splice donor site probably null
R6965:Lta4h UTSW 10 93471897 nonsense probably null
R7282:Lta4h UTSW 10 93453511 start codon destroyed probably null 0.98
R7779:Lta4h UTSW 10 93474949 missense probably benign 0.06
R8045:Lta4h UTSW 10 93469106 missense probably damaging 1.00
R8281:Lta4h UTSW 10 93453594 missense probably damaging 1.00
R8306:Lta4h UTSW 10 93482264 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ATCGTCTTAGTTGACTGCCTGG -3'
(R):5'- ATGGCACCTGCTACATCCTC -3'

Sequencing Primer
(F):5'- TAGTTGACTGCCTGGGCCTC -3'
(R):5'- CCTATGACTACCCTGTTGTTAAAAAG -3'
Posted On2016-10-06