Incidental Mutation 'R5528:Wnt3a'
ID433538
Institutional Source Beutler Lab
Gene Symbol Wnt3a
Ensembl Gene ENSMUSG00000009900
Gene Namewingless-type MMTV integration site family, member 3A
SynonymsWnt-3a
MMRRC Submission 043086-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5528 (G1)
Quality Score220
Status Not validated
Chromosome11
Chromosomal Location59248033-59290752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59275280 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 58 (N58S)
Ref Sequence ENSEMBL: ENSMUSP00000010044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010044]
Predicted Effect probably damaging
Transcript: ENSMUST00000010044
AA Change: N58S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000010044
Gene: ENSMUSG00000009900
AA Change: N58S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
WNT1 44 352 9.57e-218 SMART
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 96% amino acid identity to mouse Wnt3A protein, and 84% to human WNT3 protein, another WNT gene product. This gene is clustered with WNT14 gene, another family member, in chromosome 1q42 region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die at embryonic day 10.5-12.5 with failed development of caudal somites, notochord and structures rostral to hindlimbs. Homozygotes for a hypomorphic allele have vertebral defects and a short tail due to loss of caudal vertebrae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,066,499 L483P probably benign Het
1700025F22Rik T C 19: 11,141,635 S37G possibly damaging Het
3110043O21Rik T C 4: 35,213,556 D198G probably benign Het
4930519G04Rik T G 5: 114,874,354 probably null Het
Ablim2 C T 5: 35,856,166 Q148* probably null Het
Ap3s2 A T 7: 79,880,486 *194R probably null Het
Arpp21 C T 9: 112,149,353 A235T probably benign Het
Ccdc33 T C 9: 58,028,795 D939G probably benign Het
Celsr2 A T 3: 108,413,294 I734N probably damaging Het
Clcn1 C A 6: 42,300,341 N455K probably benign Het
Cpne8 C T 15: 90,619,690 V91I possibly damaging Het
Ddx1 A G 12: 13,229,294 V448A probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Eif2a G T 3: 58,548,512 D311Y probably damaging Het
Eif2ak4 G A 2: 118,427,938 E512K probably damaging Het
Esp15 A T 17: 39,644,749 Y69F probably benign Het
Fam102a G A 2: 32,566,327 A334T probably damaging Het
Gm5689 A G 18: 42,173,662 probably null Het
Gucy1a1 A T 3: 82,109,073 Y203N probably damaging Het
Hook3 T C 8: 26,072,293 Q248R probably damaging Het
Ifit2 T A 19: 34,573,537 V159E possibly damaging Het
Il17rd T C 14: 27,088,067 V20A possibly damaging Het
Kcnq3 T A 15: 66,025,178 D291V probably damaging Het
Klf11 A T 12: 24,654,930 M111L probably benign Het
Lama5 T A 2: 180,194,563 H1165L probably benign Het
Lmo7 A G 14: 101,902,086 N702S probably damaging Het
Lta4h T C 10: 93,471,874 V323A probably damaging Het
Mkrn3 T C 7: 62,418,987 E352G possibly damaging Het
Mtf2 T A 5: 108,094,157 L277Q probably damaging Het
Myo9b A G 8: 71,323,274 N370D probably benign Het
Nlrp4e A C 7: 23,336,891 K723T probably benign Het
Nsun3 A G 16: 62,735,326 V279A possibly damaging Het
Pde6b A G 5: 108,423,558 D459G probably benign Het
Phgdh T C 3: 98,328,339 I121V probably benign Het
Pik3r5 T C 11: 68,495,977 C811R probably damaging Het
Spaca6 A C 17: 17,831,082 I27L probably benign Het
Trmt1l G A 1: 151,454,995 V588I probably benign Het
Tshr A G 12: 91,537,193 N302D probably damaging Het
Vmn2r23 A G 6: 123,713,002 D279G probably damaging Het
Zkscan8 A G 13: 21,520,725 V276A probably damaging Het
Other mutations in Wnt3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Wnt3a APN 11 59256309 missense probably benign 0.03
R0334:Wnt3a UTSW 11 59256318 missense probably damaging 0.97
R3912:Wnt3a UTSW 11 59250002 missense possibly damaging 0.91
R4041:Wnt3a UTSW 11 59249644 missense probably damaging 1.00
R4980:Wnt3a UTSW 11 59249800 missense probably damaging 1.00
R5413:Wnt3a UTSW 11 59275356 missense probably benign 0.04
R5626:Wnt3a UTSW 11 59290583 missense probably benign 0.17
R6355:Wnt3a UTSW 11 59275232 missense probably damaging 1.00
R6700:Wnt3a UTSW 11 59249761 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGGAAGGCCTTATGATGTCC -3'
(R):5'- CAGCCATCAACATGCTGTCTC -3'

Sequencing Primer
(F):5'- GGAAGGCCTTATGATGTCCATATAG -3'
(R):5'- ATCAACATGCTGTCTCTAGGTG -3'
Posted On2016-10-06