Incidental Mutation 'R5528:Pik3r5'
ID433539
Institutional Source Beutler Lab
Gene Symbol Pik3r5
Ensembl Gene ENSMUSG00000020901
Gene Namephosphoinositide-3-kinase regulatory subunit 5
Synonyms
MMRRC Submission 043086-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R5528 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location68432121-68497849 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68495977 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 811 (C811R)
Ref Sequence ENSEMBL: ENSMUSP00000021283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021283]
Predicted Effect probably damaging
Transcript: ENSMUST00000021283
AA Change: C811R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021283
Gene: ENSMUSG00000020901
AA Change: C811R

DomainStartEndE-ValueType
Pfam:PI3K_1B_p101 6 871 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155887
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinases (PI3Ks) phosphorylate the inositol ring of phosphatidylinositol at the 3-prime position, and play important roles in cell growth, proliferation, differentiation, motility, survival and intracellular trafficking. The PI3Ks are divided into three classes: I, II and III, and only the class I PI3Ks are involved in oncogenesis. This gene encodes the 101 kD regulatory subunit of the class I PI3K gamma complex, which is a dimeric enzyme, consisting of a 110 kD catalytic subunit gamma and a regulatory subunit of either 55, 87 or 101 kD. This protein recruits the catalytic subunit from the cytosol to the plasma membrane through high-affinity interaction with G-beta-gamma proteins. Multiple alternatively spliced transcript variants encoding two distinct isoforms have been found. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significantly reduced neutrophil chemotaxis and chemokinesis in vitro and impaired neutrophil recruitment into the peritoneum in a model of thioglycollate-induced aseptic peritonitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,066,499 L483P probably benign Het
1700025F22Rik T C 19: 11,141,635 S37G possibly damaging Het
3110043O21Rik T C 4: 35,213,556 D198G probably benign Het
4930519G04Rik T G 5: 114,874,354 probably null Het
Ablim2 C T 5: 35,856,166 Q148* probably null Het
Ap3s2 A T 7: 79,880,486 *194R probably null Het
Arpp21 C T 9: 112,149,353 A235T probably benign Het
Ccdc33 T C 9: 58,028,795 D939G probably benign Het
Celsr2 A T 3: 108,413,294 I734N probably damaging Het
Clcn1 C A 6: 42,300,341 N455K probably benign Het
Cpne8 C T 15: 90,619,690 V91I possibly damaging Het
Ddx1 A G 12: 13,229,294 V448A probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Eif2a G T 3: 58,548,512 D311Y probably damaging Het
Eif2ak4 G A 2: 118,427,938 E512K probably damaging Het
Esp15 A T 17: 39,644,749 Y69F probably benign Het
Fam102a G A 2: 32,566,327 A334T probably damaging Het
Gm5689 A G 18: 42,173,662 probably null Het
Gucy1a1 A T 3: 82,109,073 Y203N probably damaging Het
Hook3 T C 8: 26,072,293 Q248R probably damaging Het
Ifit2 T A 19: 34,573,537 V159E possibly damaging Het
Il17rd T C 14: 27,088,067 V20A possibly damaging Het
Kcnq3 T A 15: 66,025,178 D291V probably damaging Het
Klf11 A T 12: 24,654,930 M111L probably benign Het
Lama5 T A 2: 180,194,563 H1165L probably benign Het
Lmo7 A G 14: 101,902,086 N702S probably damaging Het
Lta4h T C 10: 93,471,874 V323A probably damaging Het
Mkrn3 T C 7: 62,418,987 E352G possibly damaging Het
Mtf2 T A 5: 108,094,157 L277Q probably damaging Het
Myo9b A G 8: 71,323,274 N370D probably benign Het
Nlrp4e A C 7: 23,336,891 K723T probably benign Het
Nsun3 A G 16: 62,735,326 V279A possibly damaging Het
Pde6b A G 5: 108,423,558 D459G probably benign Het
Phgdh T C 3: 98,328,339 I121V probably benign Het
Spaca6 A C 17: 17,831,082 I27L probably benign Het
Trmt1l G A 1: 151,454,995 V588I probably benign Het
Tshr A G 12: 91,537,193 N302D probably damaging Het
Vmn2r23 A G 6: 123,713,002 D279G probably damaging Het
Wnt3a T C 11: 59,275,280 N58S probably damaging Het
Zkscan8 A G 13: 21,520,725 V276A probably damaging Het
Other mutations in Pik3r5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Pik3r5 APN 11 68496194 missense possibly damaging 0.68
IGL01400:Pik3r5 APN 11 68494547 missense probably benign 0.01
IGL01597:Pik3r5 APN 11 68496001 missense probably damaging 1.00
IGL01622:Pik3r5 APN 11 68486626 splice site probably null
IGL01623:Pik3r5 APN 11 68486626 splice site probably null
IGL01878:Pik3r5 APN 11 68492530 missense probably benign 0.00
IGL01953:Pik3r5 APN 11 68494171 missense probably benign 0.00
IGL02056:Pik3r5 APN 11 68490855 missense possibly damaging 0.86
IGL02345:Pik3r5 APN 11 68492726 missense probably benign 0.03
palmetto UTSW 11 68494233 missense probably damaging 1.00
Palmito UTSW 11 68492000 missense probably damaging 1.00
palms UTSW 11 68486622 critical splice donor site probably null
piranha UTSW 11 68486581 missense probably damaging 1.00
Serenoa_repens UTSW 11 68475424 nonsense probably null
IGL02799:Pik3r5 UTSW 11 68495947 missense probably damaging 0.98
R0077:Pik3r5 UTSW 11 68486622 critical splice donor site probably null
R0092:Pik3r5 UTSW 11 68492803 missense probably benign
R0105:Pik3r5 UTSW 11 68490511 missense probably damaging 0.99
R0118:Pik3r5 UTSW 11 68490480 missense probably damaging 1.00
R1204:Pik3r5 UTSW 11 68494224 missense probably benign 0.03
R1447:Pik3r5 UTSW 11 68494177 missense probably benign 0.18
R1865:Pik3r5 UTSW 11 68492492 missense probably damaging 1.00
R2034:Pik3r5 UTSW 11 68493577 missense probably damaging 0.99
R2356:Pik3r5 UTSW 11 68492917 missense probably damaging 1.00
R4588:Pik3r5 UTSW 11 68493261 intron probably benign
R4716:Pik3r5 UTSW 11 68495204 missense possibly damaging 0.48
R4960:Pik3r5 UTSW 11 68493638 missense probably benign 0.19
R5217:Pik3r5 UTSW 11 68491964 missense possibly damaging 0.67
R5518:Pik3r5 UTSW 11 68477468 missense possibly damaging 0.86
R5554:Pik3r5 UTSW 11 68494233 missense probably damaging 1.00
R5693:Pik3r5 UTSW 11 68494251 missense probably damaging 1.00
R5841:Pik3r5 UTSW 11 68492270 missense probably damaging 1.00
R6025:Pik3r5 UTSW 11 68492318 missense probably damaging 0.97
R6168:Pik3r5 UTSW 11 68492675 missense probably benign
R6243:Pik3r5 UTSW 11 68492000 missense probably damaging 1.00
R6322:Pik3r5 UTSW 11 68492741 missense probably benign
R6420:Pik3r5 UTSW 11 68475424 nonsense probably null
R6505:Pik3r5 UTSW 11 68492789 missense probably benign 0.16
R6534:Pik3r5 UTSW 11 68490617 missense possibly damaging 0.59
R6817:Pik3r5 UTSW 11 68486581 missense probably damaging 1.00
R7246:Pik3r5 UTSW 11 68492943 missense probably benign 0.01
R7459:Pik3r5 UTSW 11 68492590 missense probably benign 0.03
R7527:Pik3r5 UTSW 11 68476351 missense probably damaging 1.00
R7739:Pik3r5 UTSW 11 68490498 missense probably damaging 1.00
R7817:Pik3r5 UTSW 11 68493657 missense probably damaging 0.99
R7877:Pik3r5 UTSW 11 68490605 missense probably damaging 1.00
R7885:Pik3r5 UTSW 11 68492702 missense possibly damaging 0.57
R7960:Pik3r5 UTSW 11 68495970 missense probably benign 0.22
Z1177:Pik3r5 UTSW 11 68492896 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GGCAGTCCTGTCTCAAACTC -3'
(R):5'- CTGAATGTCATGATGGGAAGGC -3'

Sequencing Primer
(F):5'- AAACTCTCCCAGTCCCTATGGG -3'
(R):5'- TGGCTGAAGGACCTCTCG -3'
Posted On2016-10-06