Incidental Mutation 'R0481:Hadhb'
Institutional Source Beutler Lab
Gene Symbol Hadhb
Ensembl Gene ENSMUSG00000059447
Gene Namehydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), beta subunit
Synonyms4930479F15Rik, Mtpb
MMRRC Submission 038681-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R0481 (G1)
Quality Score225
Status Validated
Chromosomal Location30155248-30184593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30168545 bp
Amino Acid Change Histidine to Glutamine at position 78 (H78Q)
Ref Sequence ENSEMBL: ENSMUSP00000118296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026841] [ENSMUST00000114783] [ENSMUST00000114786] [ENSMUST00000123980] [ENSMUST00000197109]
Predicted Effect probably damaging
Transcript: ENSMUST00000026841
AA Change: H78Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026841
Gene: ENSMUSG00000059447
AA Change: H78Q

Pfam:Thiolase_N 52 325 4.6e-96 PFAM
Pfam:ketoacyl-synt 86 193 1.8e-10 PFAM
Pfam:Thiolase_C 332 472 1.5e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114783
AA Change: H78Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110431
Gene: ENSMUSG00000059447
AA Change: H78Q

Pfam:Thiolase_N 55 325 1.4e-90 PFAM
Pfam:ketoacyl-synt 90 194 1.4e-10 PFAM
Pfam:Thiolase_C 332 472 1.3e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114786
AA Change: H78Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110434
Gene: ENSMUSG00000059447
AA Change: H78Q

Pfam:Thiolase_N 52 325 4.6e-96 PFAM
Pfam:ketoacyl-synt 86 193 1.8e-10 PFAM
Pfam:Thiolase_C 332 472 1.5e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123980
AA Change: H78Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118296
Gene: ENSMUSG00000059447
AA Change: H78Q

Pfam:Thiolase_N 52 129 3.7e-20 PFAM
Pfam:Thiolase_N 119 173 3.3e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157488
Predicted Effect probably benign
Transcript: ENSMUST00000197109
Meta Mutation Damage Score 0.3234 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 95% (89/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of the mitochondrial trifunctional protein, which catalyzes the last three steps of mitochondrial beta-oxidation of long chain fatty acids. The mitochondrial membrane-bound heterocomplex is composed of four alpha and four beta subunits, with the beta subunit catalyzing the 3-ketoacyl-CoA thiolase activity. The encoded protein can also bind RNA and decreases the stability of some mRNAs. The genes of the alpha and beta subunits of the mitochondrial trifunctional protein are located adjacent to each other in the human genome in a head-to-head orientation. Mutations in this gene result in trifunctional protein deficiency. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for an ENU-induced mutation display reduced postnatal weight gain, multifocal cardiac fibrosis and hepatic steatosis, and develop cardiac arrhythmias that range from a prolonged PR interval to complete atrioventricular dissociation and lead to sudden between 9 and 16 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932429P05Rik T C X: 89,752,693 S44P probably damaging Het
9530053A07Rik A T 7: 28,153,749 D1487V probably damaging Het
Abcg4 T A 9: 44,279,369 N39Y probably benign Het
Adamts10 C T 17: 33,549,373 Q840* probably null Het
Aff2 C T X: 69,834,642 T678I probably damaging Het
Ahctf1 A G 1: 179,760,271 V1418A probably benign Het
Ankrd11 G A 8: 122,900,036 R136C probably damaging Het
Arf5 A G 6: 28,426,076 Y154C probably damaging Het
AW551984 A G 9: 39,600,616 V33A probably null Het
B4galt5 A G 2: 167,309,234 L118P probably damaging Het
Bcl9l A G 9: 44,506,682 I606V probably benign Het
Bdp1 A G 13: 100,041,454 I1969T probably benign Het
Bicd1 A T 6: 149,511,891 D260V possibly damaging Het
Cap1 A T 4: 122,863,075 H272Q possibly damaging Het
Ccnk A G 12: 108,199,309 probably benign Het
Cd209f A T 8: 4,105,558 probably null Het
Cdk13 C A 13: 17,719,494 A1123S probably damaging Het
Cdx1 C T 18: 61,020,492 R158H probably damaging Het
Chd8 A G 14: 52,237,206 S123P probably benign Het
Cwc22 G A 2: 77,908,111 A497V probably damaging Het
Cwh43 T C 5: 73,418,027 S296P probably damaging Het
Dhx38 A T 8: 109,556,216 probably benign Het
Dnah5 T A 15: 28,383,599 M2989K probably benign Het
Dpy19l4 A C 4: 11,272,993 probably benign Het
F11r A T 1: 171,461,279 H155L probably benign Het
Fitm2 A G 2: 163,469,714 V193A probably benign Het
Foxk1 T A 5: 142,448,823 S281T probably benign Het
Furin A G 7: 80,393,549 C305R probably damaging Het
Fut8 T A 12: 77,448,560 V308D probably damaging Het
Gjb3 T A 4: 127,326,332 I136F probably benign Het
Glmn A T 5: 107,560,934 S385T probably benign Het
Glp1r T A 17: 30,931,217 M371K probably benign Het
Gm906 T A 13: 50,246,964 Q442L probably benign Het
Gpr179 T C 11: 97,349,718 H293R probably damaging Het
H2-M11 A T 17: 36,548,954 R280* probably null Het
Hectd4 A G 5: 121,295,506 probably benign Het
Hexa A G 9: 59,555,410 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Hyal6 G A 6: 24,743,418 C371Y probably damaging Het
Il1rap T C 16: 26,692,835 Y210H probably damaging Het
Ino80 A T 2: 119,431,016 H722Q probably damaging Het
Kcnt1 A G 2: 25,892,496 N200S probably damaging Het
Kif27 T A 13: 58,311,264 probably benign Het
Lyst T C 13: 13,677,952 V2179A probably benign Het
Macf1 C A 4: 123,484,022 probably null Het
Mamdc4 A G 2: 25,571,216 M1T probably null Het
Mansc4 A G 6: 147,075,227 I297T possibly damaging Het
Mdn1 G A 4: 32,767,182 probably benign Het
Mib2 A G 4: 155,656,062 probably benign Het
Mon2 A G 10: 123,013,396 V1333A possibly damaging Het
Ndst2 T C 14: 20,724,468 D840G possibly damaging Het
Nell2 A T 15: 95,432,682 probably null Het
Olfr1189 A T 2: 88,592,655 I284F probably damaging Het
Olfr1301 T A 2: 111,754,585 M112K probably damaging Het
Olfr998 C A 2: 85,591,104 A188E possibly damaging Het
Pde5a C T 3: 122,818,077 probably benign Het
Phip A G 9: 82,876,716 probably benign Het
Polr2b A G 5: 77,332,082 I561V possibly damaging Het
Prkg2 A T 5: 98,994,655 probably null Het
Prl8a6 T C 13: 27,433,101 D201G probably benign Het
Ptk6 G A 2: 181,202,527 probably benign Het
Ptprn2 T C 12: 117,211,846 probably benign Het
Rdh1 G T 10: 127,763,124 R158L probably damaging Het
Rhbdl3 T C 11: 80,323,349 probably benign Het
Rims4 A T 2: 163,864,120 V198E probably damaging Het
Ripk1 T C 13: 34,009,750 S32P probably damaging Het
Rnf13 T A 3: 57,779,451 N88K probably damaging Het
Rnf13 C A 3: 57,807,053 L178I probably damaging Het
Slc17a5 G T 9: 78,538,302 probably null Het
Sorcs1 A G 19: 50,636,453 probably benign Het
Srpk1 G A 17: 28,590,244 probably benign Het
Stk10 A G 11: 32,614,708 K840E probably damaging Het
Suco A G 1: 161,862,313 probably benign Het
T2 G A 17: 8,417,175 probably null Het
Tbc1d5 A G 17: 50,919,051 S255P probably damaging Het
Tenm1 T C X: 42,536,181 Y2254C probably damaging Het
Tex9 T A 9: 72,478,396 K11* probably null Het
Tlr4 A G 4: 66,827,916 I29V probably benign Het
Tmem255a A T X: 38,199,646 V278D probably damaging Het
Trpc3 T C 3: 36,624,417 I840V probably benign Het
Trpm3 G A 19: 22,901,071 R622Q possibly damaging Het
Vmn1r214 T A 13: 23,035,294 Y319* probably null Het
Vmn1r53 A T 6: 90,223,718 V208E probably damaging Het
Vmn2r89 T C 14: 51,456,120 F309S probably damaging Het
Xirp2 T A 2: 67,509,909 F831L possibly damaging Het
Yes1 G T 5: 32,640,405 E23* probably null Het
Zfp292 A T 4: 34,810,059 M995K probably benign Het
Other mutations in Hadhb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02306:Hadhb APN 5 30166749 missense probably null 0.99
IGL02472:Hadhb APN 5 30184063 missense possibly damaging 0.68
R0110:Hadhb UTSW 5 30169485 splice site probably benign
R0578:Hadhb UTSW 5 30178806 missense probably benign
R1483:Hadhb UTSW 5 30169494 critical splice acceptor site probably null
R1552:Hadhb UTSW 5 30176933 missense probably null 0.66
R1616:Hadhb UTSW 5 30166715 missense probably damaging 1.00
R1926:Hadhb UTSW 5 30180937 missense possibly damaging 0.94
R2064:Hadhb UTSW 5 30173798 splice site probably null
R5066:Hadhb UTSW 5 30164096 intron probably benign
R5298:Hadhb UTSW 5 30177011 critical splice donor site probably null
R6216:Hadhb UTSW 5 30174931 missense probably benign 0.00
R6787:Hadhb UTSW 5 30155249 unclassified probably benign
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tgacatacacctttaatcttgacaac -3'
Posted On2013-05-23