Incidental Mutation 'R5528:Ddx1'
ID433540
Institutional Source Beutler Lab
Gene Symbol Ddx1
Ensembl Gene ENSMUSG00000037149
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 1
Synonyms
MMRRC Submission 043086-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5528 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location13216973-13249213 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13229294 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 448 (V448A)
Ref Sequence ENSEMBL: ENSMUSP00000065987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071103]
Predicted Effect probably damaging
Transcript: ENSMUST00000071103
AA Change: V448A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065987
Gene: ENSMUSG00000037149
AA Change: V448A

DomainStartEndE-ValueType
DEXDc 21 444 1.95e-47 SMART
SPRY 130 246 1.91e-34 SMART
HELICc 520 610 8.28e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221028
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein of unknown function. It shows high transcription levels in 2 retinoblastoma cell lines and in tissues of neuroectodermal origin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,066,499 L483P probably benign Het
1700025F22Rik T C 19: 11,141,635 S37G possibly damaging Het
3110043O21Rik T C 4: 35,213,556 D198G probably benign Het
4930519G04Rik T G 5: 114,874,354 probably null Het
Ablim2 C T 5: 35,856,166 Q148* probably null Het
Ap3s2 A T 7: 79,880,486 *194R probably null Het
Arpp21 C T 9: 112,149,353 A235T probably benign Het
Ccdc33 T C 9: 58,028,795 D939G probably benign Het
Celsr2 A T 3: 108,413,294 I734N probably damaging Het
Clcn1 C A 6: 42,300,341 N455K probably benign Het
Cpne8 C T 15: 90,619,690 V91I possibly damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Eif2a G T 3: 58,548,512 D311Y probably damaging Het
Eif2ak4 G A 2: 118,427,938 E512K probably damaging Het
Esp15 A T 17: 39,644,749 Y69F probably benign Het
Fam102a G A 2: 32,566,327 A334T probably damaging Het
Gm5689 A G 18: 42,173,662 probably null Het
Gucy1a1 A T 3: 82,109,073 Y203N probably damaging Het
Hook3 T C 8: 26,072,293 Q248R probably damaging Het
Ifit2 T A 19: 34,573,537 V159E possibly damaging Het
Il17rd T C 14: 27,088,067 V20A possibly damaging Het
Kcnq3 T A 15: 66,025,178 D291V probably damaging Het
Klf11 A T 12: 24,654,930 M111L probably benign Het
Lama5 T A 2: 180,194,563 H1165L probably benign Het
Lmo7 A G 14: 101,902,086 N702S probably damaging Het
Lta4h T C 10: 93,471,874 V323A probably damaging Het
Mkrn3 T C 7: 62,418,987 E352G possibly damaging Het
Mtf2 T A 5: 108,094,157 L277Q probably damaging Het
Myo9b A G 8: 71,323,274 N370D probably benign Het
Nlrp4e A C 7: 23,336,891 K723T probably benign Het
Nsun3 A G 16: 62,735,326 V279A possibly damaging Het
Pde6b A G 5: 108,423,558 D459G probably benign Het
Phgdh T C 3: 98,328,339 I121V probably benign Het
Pik3r5 T C 11: 68,495,977 C811R probably damaging Het
Spaca6 A C 17: 17,831,082 I27L probably benign Het
Trmt1l G A 1: 151,454,995 V588I probably benign Het
Tshr A G 12: 91,537,193 N302D probably damaging Het
Vmn2r23 A G 6: 123,713,002 D279G probably damaging Het
Wnt3a T C 11: 59,275,280 N58S probably damaging Het
Zkscan8 A G 13: 21,520,725 V276A probably damaging Het
Other mutations in Ddx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Ddx1 APN 12 13227459 splice site probably benign
IGL00725:Ddx1 APN 12 13245690 missense probably damaging 1.00
IGL00958:Ddx1 APN 12 13240848 splice site probably null
IGL01786:Ddx1 APN 12 13229136 missense probably benign
IGL02832:Ddx1 APN 12 13227317 nonsense probably null
IGL02983:Ddx1 APN 12 13223862 missense probably damaging 1.00
R0201:Ddx1 UTSW 12 13223808 missense probably damaging 1.00
R0931:Ddx1 UTSW 12 13237817 splice site probably benign
R1434:Ddx1 UTSW 12 13237231 missense probably benign 0.01
R1558:Ddx1 UTSW 12 13239541 missense probably damaging 1.00
R1673:Ddx1 UTSW 12 13244966 critical splice donor site probably null
R1854:Ddx1 UTSW 12 13229331 missense probably benign 0.19
R2910:Ddx1 UTSW 12 13231440 splice site probably null
R2911:Ddx1 UTSW 12 13231440 splice site probably null
R4181:Ddx1 UTSW 12 13231503 nonsense probably null
R4182:Ddx1 UTSW 12 13231503 nonsense probably null
R4183:Ddx1 UTSW 12 13231503 nonsense probably null
R4231:Ddx1 UTSW 12 13223857 missense possibly damaging 0.74
R4234:Ddx1 UTSW 12 13223857 missense possibly damaging 0.74
R4235:Ddx1 UTSW 12 13223857 missense possibly damaging 0.74
R4243:Ddx1 UTSW 12 13240909 nonsense probably null
R4717:Ddx1 UTSW 12 13240887 missense probably damaging 1.00
R4821:Ddx1 UTSW 12 13239147 missense probably damaging 1.00
R5032:Ddx1 UTSW 12 13223992 missense probably damaging 1.00
R5082:Ddx1 UTSW 12 13220435 nonsense probably null
R5997:Ddx1 UTSW 12 13237799 missense probably damaging 1.00
R6398:Ddx1 UTSW 12 13245720 missense probably damaging 1.00
R6891:Ddx1 UTSW 12 13236095 missense probably benign 0.25
R7085:Ddx1 UTSW 12 13229355 missense probably damaging 1.00
R7125:Ddx1 UTSW 12 13243863 missense probably benign 0.18
R7307:Ddx1 UTSW 12 13223959 missense probably damaging 1.00
R7388:Ddx1 UTSW 12 13225455 missense probably null 1.00
R7393:Ddx1 UTSW 12 13230353 missense probably benign 0.03
R7460:Ddx1 UTSW 12 13231439 splice site probably null
R8310:Ddx1 UTSW 12 13224279 intron probably benign
R8479:Ddx1 UTSW 12 13220748 missense probably damaging 0.97
X0011:Ddx1 UTSW 12 13229415 missense probably damaging 1.00
X0028:Ddx1 UTSW 12 13243866 missense probably benign 0.00
Z1177:Ddx1 UTSW 12 13229259 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GACTGTTAGCACCAGGTCTTGTG -3'
(R):5'- AACTAGTGTGATAGAAAGCTGACTG -3'

Sequencing Primer
(F):5'- AGCACCAGGTCTTGTGTTATC -3'
(R):5'- AGCTGACTGTTATAAAAGTTGGTCTG -3'
Posted On2016-10-06