Incidental Mutation 'R5528:Klf11'
ID433541
Institutional Source Beutler Lab
Gene Symbol Klf11
Ensembl Gene ENSMUSG00000020653
Gene NameKruppel-like factor 11
SynonymsTieg2b, D12Ertd427e, Tieg3, Tieg2
MMRRC Submission 043086-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5528 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location24651274-24662789 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24654930 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 111 (M111L)
Ref Sequence ENSEMBL: ENSMUSP00000121730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020982] [ENSMUST00000139940] [ENSMUST00000144046] [ENSMUST00000146894]
Predicted Effect probably benign
Transcript: ENSMUST00000020982
AA Change: M128L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020982
Gene: ENSMUSG00000020653
AA Change: M128L

DomainStartEndE-ValueType
low complexity region 267 275 N/A INTRINSIC
low complexity region 356 367 N/A INTRINSIC
ZnF_C2H2 384 408 5.9e-3 SMART
ZnF_C2H2 414 438 9.22e-5 SMART
ZnF_C2H2 444 466 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139940
Predicted Effect probably benign
Transcript: ENSMUST00000144046
AA Change: M111L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000146894
AA Change: M111L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor that binds to SP1-like sequences in epsilon- and gamma-globin gene promoters. This binding inhibits cell growth and causes apoptosis. Defects in this gene are a cause of maturity-onset diabetes of the young type 7 (MODY7). Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile, show normal hematopoiesis, growth and development, and display no evidence of increased tumor formation following gamma-irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,066,499 L483P probably benign Het
1700025F22Rik T C 19: 11,141,635 S37G possibly damaging Het
3110043O21Rik T C 4: 35,213,556 D198G probably benign Het
4930519G04Rik T G 5: 114,874,354 probably null Het
Ablim2 C T 5: 35,856,166 Q148* probably null Het
Ap3s2 A T 7: 79,880,486 *194R probably null Het
Arpp21 C T 9: 112,149,353 A235T probably benign Het
Ccdc33 T C 9: 58,028,795 D939G probably benign Het
Celsr2 A T 3: 108,413,294 I734N probably damaging Het
Clcn1 C A 6: 42,300,341 N455K probably benign Het
Cpne8 C T 15: 90,619,690 V91I possibly damaging Het
Ddx1 A G 12: 13,229,294 V448A probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Eif2a G T 3: 58,548,512 D311Y probably damaging Het
Eif2ak4 G A 2: 118,427,938 E512K probably damaging Het
Esp15 A T 17: 39,644,749 Y69F probably benign Het
Fam102a G A 2: 32,566,327 A334T probably damaging Het
Gm5689 A G 18: 42,173,662 probably null Het
Gucy1a1 A T 3: 82,109,073 Y203N probably damaging Het
Hook3 T C 8: 26,072,293 Q248R probably damaging Het
Ifit2 T A 19: 34,573,537 V159E possibly damaging Het
Il17rd T C 14: 27,088,067 V20A possibly damaging Het
Kcnq3 T A 15: 66,025,178 D291V probably damaging Het
Lama5 T A 2: 180,194,563 H1165L probably benign Het
Lmo7 A G 14: 101,902,086 N702S probably damaging Het
Lta4h T C 10: 93,471,874 V323A probably damaging Het
Mkrn3 T C 7: 62,418,987 E352G possibly damaging Het
Mtf2 T A 5: 108,094,157 L277Q probably damaging Het
Myo9b A G 8: 71,323,274 N370D probably benign Het
Nlrp4e A C 7: 23,336,891 K723T probably benign Het
Nsun3 A G 16: 62,735,326 V279A possibly damaging Het
Pde6b A G 5: 108,423,558 D459G probably benign Het
Phgdh T C 3: 98,328,339 I121V probably benign Het
Pik3r5 T C 11: 68,495,977 C811R probably damaging Het
Spaca6 A C 17: 17,831,082 I27L probably benign Het
Trmt1l G A 1: 151,454,995 V588I probably benign Het
Tshr A G 12: 91,537,193 N302D probably damaging Het
Vmn2r23 A G 6: 123,713,002 D279G probably damaging Het
Wnt3a T C 11: 59,275,280 N58S probably damaging Het
Zkscan8 A G 13: 21,520,725 V276A probably damaging Het
Other mutations in Klf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Klf11 APN 12 24660369 missense probably benign 0.01
IGL02202:Klf11 APN 12 24653632 missense probably benign 0.37
IGL02527:Klf11 APN 12 24655323 missense probably benign 0.31
IGL02964:Klf11 APN 12 24655627 missense probably damaging 1.00
R0254:Klf11 UTSW 12 24653583 missense probably damaging 1.00
R0553:Klf11 UTSW 12 24655090 missense probably benign 0.12
R0739:Klf11 UTSW 12 24660248 missense probably damaging 1.00
R1584:Klf11 UTSW 12 24655305 missense probably damaging 1.00
R1592:Klf11 UTSW 12 24653738 missense probably damaging 1.00
R2356:Klf11 UTSW 12 24653583 missense probably damaging 1.00
R3085:Klf11 UTSW 12 24655491 missense probably benign
R4690:Klf11 UTSW 12 24655072 missense probably damaging 0.97
R5023:Klf11 UTSW 12 24655359 missense probably benign 0.00
R5483:Klf11 UTSW 12 24655411 nonsense probably null
R6148:Klf11 UTSW 12 24651568 critical splice donor site probably null
R6698:Klf11 UTSW 12 24653619 missense probably damaging 1.00
R6799:Klf11 UTSW 12 24655639 missense possibly damaging 0.59
R7317:Klf11 UTSW 12 24655519 missense possibly damaging 0.59
R7384:Klf11 UTSW 12 24653743 missense probably damaging 0.97
R7440:Klf11 UTSW 12 24655491 missense probably benign
R7473:Klf11 UTSW 12 24655142 splice site probably null
R7477:Klf11 UTSW 12 24653563 missense probably benign 0.01
R7658:Klf11 UTSW 12 24653671 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCAGTGCGGTCAGATAATATC -3'
(R):5'- TTCGAGGTGGTCCAGCAAAC -3'

Sequencing Primer
(F):5'- CAGTGCGGTCAGATAATATCTTCGC -3'
(R):5'- GTCCAGCAAACGCTCCTGTC -3'
Posted On2016-10-06