Incidental Mutation 'R5528:Tshr'
ID433543
Institutional Source Beutler Lab
Gene Symbol Tshr
Ensembl Gene ENSMUSG00000020963
Gene Namethyroid stimulating hormone receptor
Synonymspet, hyt, hypothroid
MMRRC Submission 043086-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.376) question?
Stock #R5528 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location91384563-91549808 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91537193 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 302 (N302D)
Ref Sequence ENSEMBL: ENSMUSP00000021346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021346] [ENSMUST00000186437] [ENSMUST00000221216]
Predicted Effect probably damaging
Transcript: ENSMUST00000021346
AA Change: N302D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021346
Gene: ENSMUSG00000020963
AA Change: N302D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:LRR_5 53 153 9.5e-7 PFAM
Pfam:LRR_5 148 244 5.1e-5 PFAM
Pfam:7tm_1 431 678 2.6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186437
SMART Domains Protein: ENSMUSP00000139632
Gene: ENSMUSG00000020963

DomainStartEndE-ValueType
Pfam:7tm_1 1 86 6.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221216
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein and a major controller of thyroid cell metabolism. The encoded protein is a receptor for thyrothropin and thyrostimulin, and its activity is mediated by adenylate cyclase. Defects in this gene are a cause of several types of hyperthyroidism. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene exhibit profound hypothyroidism, developmental and growth retardation, impaired hearing with cochlear defects, and infertility. One mutation results in high postweaning mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,066,499 L483P probably benign Het
1700025F22Rik T C 19: 11,141,635 S37G possibly damaging Het
3110043O21Rik T C 4: 35,213,556 D198G probably benign Het
4930519G04Rik T G 5: 114,874,354 probably null Het
Ablim2 C T 5: 35,856,166 Q148* probably null Het
Ap3s2 A T 7: 79,880,486 *194R probably null Het
Arpp21 C T 9: 112,149,353 A235T probably benign Het
Ccdc33 T C 9: 58,028,795 D939G probably benign Het
Celsr2 A T 3: 108,413,294 I734N probably damaging Het
Clcn1 C A 6: 42,300,341 N455K probably benign Het
Cpne8 C T 15: 90,619,690 V91I possibly damaging Het
Ddx1 A G 12: 13,229,294 V448A probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Eif2a G T 3: 58,548,512 D311Y probably damaging Het
Eif2ak4 G A 2: 118,427,938 E512K probably damaging Het
Esp15 A T 17: 39,644,749 Y69F probably benign Het
Fam102a G A 2: 32,566,327 A334T probably damaging Het
Gm5689 A G 18: 42,173,662 probably null Het
Gucy1a1 A T 3: 82,109,073 Y203N probably damaging Het
Hook3 T C 8: 26,072,293 Q248R probably damaging Het
Ifit2 T A 19: 34,573,537 V159E possibly damaging Het
Il17rd T C 14: 27,088,067 V20A possibly damaging Het
Kcnq3 T A 15: 66,025,178 D291V probably damaging Het
Klf11 A T 12: 24,654,930 M111L probably benign Het
Lama5 T A 2: 180,194,563 H1165L probably benign Het
Lmo7 A G 14: 101,902,086 N702S probably damaging Het
Lta4h T C 10: 93,471,874 V323A probably damaging Het
Mkrn3 T C 7: 62,418,987 E352G possibly damaging Het
Mtf2 T A 5: 108,094,157 L277Q probably damaging Het
Myo9b A G 8: 71,323,274 N370D probably benign Het
Nlrp4e A C 7: 23,336,891 K723T probably benign Het
Nsun3 A G 16: 62,735,326 V279A possibly damaging Het
Pde6b A G 5: 108,423,558 D459G probably benign Het
Phgdh T C 3: 98,328,339 I121V probably benign Het
Pik3r5 T C 11: 68,495,977 C811R probably damaging Het
Spaca6 A C 17: 17,831,082 I27L probably benign Het
Trmt1l G A 1: 151,454,995 V588I probably benign Het
Vmn2r23 A G 6: 123,713,002 D279G probably damaging Het
Wnt3a T C 11: 59,275,280 N58S probably damaging Het
Zkscan8 A G 13: 21,520,725 V276A probably damaging Het
Other mutations in Tshr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00647:Tshr APN 12 91537500 missense probably damaging 1.00
IGL01503:Tshr APN 12 91511934 missense probably damaging 1.00
IGL01730:Tshr APN 12 91519303 missense possibly damaging 0.93
IGL02109:Tshr APN 12 91537992 missense probably damaging 1.00
IGL02199:Tshr APN 12 91538283 missense probably damaging 1.00
IGL02439:Tshr APN 12 91537547 missense probably damaging 0.97
IGL02696:Tshr APN 12 91493329 missense possibly damaging 0.72
IGL03170:Tshr APN 12 91537869 missense probably damaging 1.00
IGL03208:Tshr APN 12 91533942 missense probably damaging 1.00
freckle UTSW 12 91538226 nonsense probably null
R0017:Tshr UTSW 12 91537886 missense possibly damaging 0.95
R0017:Tshr UTSW 12 91537886 missense possibly damaging 0.95
R0067:Tshr UTSW 12 91505283 missense probably damaging 1.00
R0419:Tshr UTSW 12 91537869 missense probably damaging 1.00
R0658:Tshr UTSW 12 91538226 nonsense probably null
R0724:Tshr UTSW 12 91538286 missense probably damaging 1.00
R1170:Tshr UTSW 12 91538097 missense probably damaging 1.00
R1188:Tshr UTSW 12 91502168 missense probably benign 0.00
R1548:Tshr UTSW 12 91534031 missense probably damaging 1.00
R1677:Tshr UTSW 12 91537341 missense possibly damaging 0.81
R1808:Tshr UTSW 12 91537316 missense probably benign 0.00
R1934:Tshr UTSW 12 91537181 missense probably damaging 0.99
R3980:Tshr UTSW 12 91537743 missense probably damaging 1.00
R4008:Tshr UTSW 12 91537494 missense probably benign 0.21
R4828:Tshr UTSW 12 91537790 missense probably damaging 1.00
R4903:Tshr UTSW 12 91401188 missense probably benign 0.09
R4958:Tshr UTSW 12 91538187 missense probably damaging 1.00
R5949:Tshr UTSW 12 91537218 missense probably damaging 1.00
R6136:Tshr UTSW 12 91538234 missense probably benign 0.34
R6147:Tshr UTSW 12 91538235 missense possibly damaging 0.84
R6454:Tshr UTSW 12 91538549 missense probably benign 0.33
R6572:Tshr UTSW 12 91538360 missense probably benign 0.29
R6884:Tshr UTSW 12 91538102 missense probably damaging 1.00
R6986:Tshr UTSW 12 91533957 missense probably damaging 0.97
R7403:Tshr UTSW 12 91497774 missense probably damaging 1.00
R7691:Tshr UTSW 12 91497741 missense probably benign 0.00
R7741:Tshr UTSW 12 91533969 nonsense probably null
R7769:Tshr UTSW 12 91538270 missense probably damaging 1.00
R7784:Tshr UTSW 12 91505305 missense probably benign 0.02
R7934:Tshr UTSW 12 91511928 missense possibly damaging 0.88
R8060:Tshr UTSW 12 91538360 missense probably benign 0.12
R8168:Tshr UTSW 12 91511965 missense probably benign 0.19
Z1176:Tshr UTSW 12 91538491 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TGACCTTCATGCCACACTGG -3'
(R):5'- TTTTGAGCTCTTGGCCGAAACC -3'

Sequencing Primer
(F):5'- TCATGCCACACTGGTGCAC -3'
(R):5'- TCATCCTCTTGTTCTTCAAAGAAGAC -3'
Posted On2016-10-06