Incidental Mutation 'R5528:Il17rd'
ID433545
Institutional Source Beutler Lab
Gene Symbol Il17rd
Ensembl Gene ENSMUSG00000040717
Gene Nameinterleukin 17 receptor D
Synonyms2810004A10Rik, Sef, Sef-S
MMRRC Submission 043086-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5528 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location27038941-27107286 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27088067 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 20 (V20A)
Ref Sequence ENSEMBL: ENSMUSP00000153543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035336] [ENSMUST00000223942] [ENSMUST00000225146] [ENSMUST00000226105]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035336
AA Change: V164A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000036076
Gene: ENSMUSG00000040717
AA Change: V164A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:IL17R_D_N 48 169 2.7e-68 PFAM
Pfam:SEFIR 356 511 9.6e-56 PFAM
low complexity region 667 684 N/A INTRINSIC
low complexity region 688 705 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223942
Predicted Effect possibly damaging
Transcript: ENSMUST00000225146
AA Change: V20A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225829
Predicted Effect possibly damaging
Transcript: ENSMUST00000226105
AA Change: V20A

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein belonging to the interleukin-17 receptor (IL-17R) protein family. The encoded protein is a component of the interleukin-17 receptor signaling complex, and the interaction between this protein and IL-17R does not require the interleukin. The gene product also affects fibroblast growth factor signaling, inhibiting or stimulating growth through MAPK/ERK signaling. Alternate splicing generates multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and show no obvious phenotype. A subset of mice homozygous for a gene-trapped allele display cochlear nucleus defects and abnormal auditory brainstem responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,066,499 L483P probably benign Het
1700025F22Rik T C 19: 11,141,635 S37G possibly damaging Het
3110043O21Rik T C 4: 35,213,556 D198G probably benign Het
4930519G04Rik T G 5: 114,874,354 probably null Het
Ablim2 C T 5: 35,856,166 Q148* probably null Het
Ap3s2 A T 7: 79,880,486 *194R probably null Het
Arpp21 C T 9: 112,149,353 A235T probably benign Het
Ccdc33 T C 9: 58,028,795 D939G probably benign Het
Celsr2 A T 3: 108,413,294 I734N probably damaging Het
Clcn1 C A 6: 42,300,341 N455K probably benign Het
Cpne8 C T 15: 90,619,690 V91I possibly damaging Het
Ddx1 A G 12: 13,229,294 V448A probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Eif2a G T 3: 58,548,512 D311Y probably damaging Het
Eif2ak4 G A 2: 118,427,938 E512K probably damaging Het
Esp15 A T 17: 39,644,749 Y69F probably benign Het
Fam102a G A 2: 32,566,327 A334T probably damaging Het
Gm5689 A G 18: 42,173,662 probably null Het
Gucy1a1 A T 3: 82,109,073 Y203N probably damaging Het
Hook3 T C 8: 26,072,293 Q248R probably damaging Het
Ifit2 T A 19: 34,573,537 V159E possibly damaging Het
Kcnq3 T A 15: 66,025,178 D291V probably damaging Het
Klf11 A T 12: 24,654,930 M111L probably benign Het
Lama5 T A 2: 180,194,563 H1165L probably benign Het
Lmo7 A G 14: 101,902,086 N702S probably damaging Het
Lta4h T C 10: 93,471,874 V323A probably damaging Het
Mkrn3 T C 7: 62,418,987 E352G possibly damaging Het
Mtf2 T A 5: 108,094,157 L277Q probably damaging Het
Myo9b A G 8: 71,323,274 N370D probably benign Het
Nlrp4e A C 7: 23,336,891 K723T probably benign Het
Nsun3 A G 16: 62,735,326 V279A possibly damaging Het
Pde6b A G 5: 108,423,558 D459G probably benign Het
Phgdh T C 3: 98,328,339 I121V probably benign Het
Pik3r5 T C 11: 68,495,977 C811R probably damaging Het
Spaca6 A C 17: 17,831,082 I27L probably benign Het
Trmt1l G A 1: 151,454,995 V588I probably benign Het
Tshr A G 12: 91,537,193 N302D probably damaging Het
Vmn2r23 A G 6: 123,713,002 D279G probably damaging Het
Wnt3a T C 11: 59,275,280 N58S probably damaging Het
Zkscan8 A G 13: 21,520,725 V276A probably damaging Het
Other mutations in Il17rd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Il17rd APN 14 27095944 missense probably damaging 1.00
IGL02274:Il17rd APN 14 27099910 missense probably damaging 1.00
IGL02732:Il17rd APN 14 27087419 missense probably damaging 1.00
IGL03118:Il17rd APN 14 27093395 critical splice acceptor site probably null
IGL03175:Il17rd APN 14 27100006 missense probably damaging 1.00
FR4304:Il17rd UTSW 14 27082680 utr 5 prime probably benign
FR4449:Il17rd UTSW 14 27082678 utr 5 prime probably benign
FR4737:Il17rd UTSW 14 27082680 utr 5 prime probably benign
FR4976:Il17rd UTSW 14 27082677 utr 5 prime probably benign
R0063:Il17rd UTSW 14 27082733 missense probably damaging 1.00
R0063:Il17rd UTSW 14 27082734 nonsense probably null
R0076:Il17rd UTSW 14 27094854 missense probably damaging 1.00
R0452:Il17rd UTSW 14 27091931 missense probably damaging 1.00
R1540:Il17rd UTSW 14 27099958 missense probably damaging 1.00
R1760:Il17rd UTSW 14 27091806 nonsense probably null
R2192:Il17rd UTSW 14 27094878 missense probably damaging 1.00
R2886:Il17rd UTSW 14 27099553 missense probably damaging 1.00
R3688:Il17rd UTSW 14 27039148 missense probably null 0.14
R4534:Il17rd UTSW 14 27096062 missense probably damaging 0.98
R5042:Il17rd UTSW 14 27096041 missense probably damaging 1.00
R5410:Il17rd UTSW 14 27095911 missense probably damaging 1.00
R5829:Il17rd UTSW 14 27092085 splice site probably null
R5919:Il17rd UTSW 14 27096044 missense probably damaging 0.99
R6305:Il17rd UTSW 14 27095942 missense possibly damaging 0.77
R6739:Il17rd UTSW 14 27099531 missense possibly damaging 0.55
R6829:Il17rd UTSW 14 27087422 nonsense probably null
R7301:Il17rd UTSW 14 27076391 missense possibly damaging 0.62
R7336:Il17rd UTSW 14 27087546 missense probably benign 0.00
R7521:Il17rd UTSW 14 27094866 missense probably benign 0.05
R7649:Il17rd UTSW 14 27039210 missense probably benign 0.22
R7741:Il17rd UTSW 14 27100336 missense probably damaging 1.00
R7814:Il17rd UTSW 14 27100117 missense probably benign 0.20
R8363:Il17rd UTSW 14 27091949 missense probably damaging 1.00
Z1177:Il17rd UTSW 14 27100261 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCCTTCTGTAGCATCTGGGATT -3'
(R):5'- TCATTGATGTGAGTTTGCTTCTC -3'

Sequencing Primer
(F):5'- CTGTAGCATCTGGGATTTGAAACC -3'
(R):5'- CACCCTACTTACTCTGTATCAGTAC -3'
Posted On2016-10-06