Mutagenetix > Incidental Mutations

Incidental Mutation 'R5528:Il17rd'

433545

Institutional Source

Beutler Lab

Gene Symbol

Il17rd

Ensembl Gene

ENSMUSG00000040717

Gene Name

interleukin 17 receptor D

Synonyms

2810004A10Rik, Sef, Sef-S

MMRRC Submission

043086-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5528 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

27038941-27107286 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 27088067 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 20 (V20A)

Ref Sequence

ENSEMBL: ENSMUSP00000153543 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035336] [ENSMUST00000223942] [ENSMUST00000225146] [ENSMUST00000226105]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035336
AA Change: V164A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000036076
Gene: ENSMUSG00000040717
AA Change: V164A

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	26	36	N/A	INTRINSIC
Pfam:IL17R_D_N	48	169	2.7e-68	PFAM
Pfam:SEFIR	356	511	9.6e-56	PFAM
low complexity region	667	684	N/A	INTRINSIC
low complexity region	688	705	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000223942

Predicted Effect

possibly damaging
Transcript: ENSMUST00000225146
AA Change: V20A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225829

Predicted Effect

possibly damaging
Transcript: ENSMUST00000226105
AA Change: V20A

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)

Coding Region Coverage

1x: 98.6%
3x: 97.4%
10x: 95.4%
20x: 91.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein belonging to the interleukin-17 receptor (IL-17R) protein family. The encoded protein is a component of the interleukin-17 receptor signaling complex, and the interaction between this protein and IL-17R does not require the interleukin. The gene product also affects fibroblast growth factor signaling, inhibiting or stimulating growth through MAPK/ERK signaling. Alternate splicing generates multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and show no obvious phenotype. A subset of mice homozygous for a gene-trapped allele display cochlear nucleus defects and abnormal auditory brainstem responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	C	3: 138,066,499	L483P	probably benign	Het
1700025F22Rik	T	C	19: 11,141,635	S37G	possibly damaging	Het
3110043O21Rik	T	C	4: 35,213,556	D198G	probably benign	Het
4930519G04Rik	T	G	5: 114,874,354		probably null	Het
Ablim2	C	T	5: 35,856,166	Q148*	probably null	Het
Ap3s2	A	T	7: 79,880,486	*194R	probably null	Het
Arpp21	C	T	9: 112,149,353	A235T	probably benign	Het
Ccdc33	T	C	9: 58,028,795	D939G	probably benign	Het
Celsr2	A	T	3: 108,413,294	I734N	probably damaging	Het
Clcn1	C	A	6: 42,300,341	N455K	probably benign	Het
Cpne8	C	T	15: 90,619,690	V91I	possibly damaging	Het
Ddx1	A	G	12: 13,229,294	V448A	probably damaging	Het
Dnhd1	G	A	7: 105,703,209	R2523Q	probably damaging	Het
Eif2a	G	T	3: 58,548,512	D311Y	probably damaging	Het
Eif2ak4	G	A	2: 118,427,938	E512K	probably damaging	Het
Esp15	A	T	17: 39,644,749	Y69F	probably benign	Het
Fam102a	G	A	2: 32,566,327	A334T	probably damaging	Het
Gm5689	A	G	18: 42,173,662		probably null	Het
Gucy1a1	A	T	3: 82,109,073	Y203N	probably damaging	Het
Hook3	T	C	8: 26,072,293	Q248R	probably damaging	Het
Ifit2	T	A	19: 34,573,537	V159E	possibly damaging	Het
Kcnq3	T	A	15: 66,025,178	D291V	probably damaging	Het
Klf11	A	T	12: 24,654,930	M111L	probably benign	Het
Lama5	T	A	2: 180,194,563	H1165L	probably benign	Het
Lmo7	A	G	14: 101,902,086	N702S	probably damaging	Het
Lta4h	T	C	10: 93,471,874	V323A	probably damaging	Het
Mkrn3	T	C	7: 62,418,987	E352G	possibly damaging	Het
Mtf2	T	A	5: 108,094,157	L277Q	probably damaging	Het
Myo9b	A	G	8: 71,323,274	N370D	probably benign	Het
Nlrp4e	A	C	7: 23,336,891	K723T	probably benign	Het
Nsun3	A	G	16: 62,735,326	V279A	possibly damaging	Het
Pde6b	A	G	5: 108,423,558	D459G	probably benign	Het
Phgdh	T	C	3: 98,328,339	I121V	probably benign	Het
Pik3r5	T	C	11: 68,495,977	C811R	probably damaging	Het
Spaca6	A	C	17: 17,831,082	I27L	probably benign	Het
Trmt1l	G	A	1: 151,454,995	V588I	probably benign	Het
Tshr	A	G	12: 91,537,193	N302D	probably damaging	Het
Vmn2r23	A	G	6: 123,713,002	D279G	probably damaging	Het
Wnt3a	T	C	11: 59,275,280	N58S	probably damaging	Het
Zkscan8	A	G	13: 21,520,725	V276A	probably damaging	Het

Other mutations in Il17rd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01349:Il17rd	APN	14	27095944	missense	probably damaging	1.00
IGL02274:Il17rd	APN	14	27099910	missense	probably damaging	1.00
IGL02732:Il17rd	APN	14	27087419	missense	probably damaging	1.00
IGL03118:Il17rd	APN	14	27093395	critical splice acceptor site	probably null
IGL03175:Il17rd	APN	14	27100006	missense	probably damaging	1.00
FR4304:Il17rd	UTSW	14	27082680	utr 5 prime	probably benign
FR4449:Il17rd	UTSW	14	27082678	utr 5 prime	probably benign
FR4737:Il17rd	UTSW	14	27082680	utr 5 prime	probably benign
FR4976:Il17rd	UTSW	14	27082677	utr 5 prime	probably benign
R0063:Il17rd	UTSW	14	27082733	missense	probably damaging	1.00
R0063:Il17rd	UTSW	14	27082734	nonsense	probably null
R0076:Il17rd	UTSW	14	27094854	missense	probably damaging	1.00
R0452:Il17rd	UTSW	14	27091931	missense	probably damaging	1.00
R1540:Il17rd	UTSW	14	27099958	missense	probably damaging	1.00
R1760:Il17rd	UTSW	14	27091806	nonsense	probably null
R2192:Il17rd	UTSW	14	27094878	missense	probably damaging	1.00
R2886:Il17rd	UTSW	14	27099553	missense	probably damaging	1.00
R3688:Il17rd	UTSW	14	27039148	missense	probably null	0.14
R4534:Il17rd	UTSW	14	27096062	missense	probably damaging	0.98
R5042:Il17rd	UTSW	14	27096041	missense	probably damaging	1.00
R5410:Il17rd	UTSW	14	27095911	missense	probably damaging	1.00
R5829:Il17rd	UTSW	14	27092085	splice site	probably null
R5919:Il17rd	UTSW	14	27096044	missense	probably damaging	0.99
R6305:Il17rd	UTSW	14	27095942	missense	possibly damaging	0.77
R6739:Il17rd	UTSW	14	27099531	missense	possibly damaging	0.55
R6829:Il17rd	UTSW	14	27087422	nonsense	probably null
R7301:Il17rd	UTSW	14	27076391	missense	possibly damaging	0.62
R7336:Il17rd	UTSW	14	27087546	missense	probably benign	0.00
R7521:Il17rd	UTSW	14	27094866	missense	probably benign	0.05
R7649:Il17rd	UTSW	14	27039210	missense	probably benign	0.22
R7741:Il17rd	UTSW	14	27100336	missense	probably damaging	1.00
R7814:Il17rd	UTSW	14	27100117	missense	probably benign	0.20
R8363:Il17rd	UTSW	14	27091949	missense	probably damaging	1.00
Z1177:Il17rd	UTSW	14	27100261	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TCCTTCTGTAGCATCTGGGATT -3'
(R):5'- TCATTGATGTGAGTTTGCTTCTC -3'

Sequencing Primer
(F):5'- CTGTAGCATCTGGGATTTGAAACC -3'
(R):5'- CACCCTACTTACTCTGTATCAGTAC -3'

Posted On

2016-10-06