Incidental Mutation 'R5528:Esp15'
ID 433552
Institutional Source Beutler Lab
Gene Symbol Esp15
Ensembl Gene ENSMUSG00000095104
Gene Name exocrine gland secreted peptide 15
Synonyms Gm9041
MMRRC Submission 043086-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.252) question?
Stock # R5528 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 39951848-39956558 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 39955640 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 69 (Y69F)
Ref Sequence ENSEMBL: ENSMUSP00000137292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178929]
AlphaFold A8R0U8
Predicted Effect probably benign
Transcript: ENSMUST00000178929
AA Change: Y69F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137292
Gene: ENSMUSG00000095104
AA Change: Y69F

DomainStartEndE-ValueType
Pfam:ESP 24 71 9.4e-9 PFAM
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 137,772,260 (GRCm39) L483P probably benign Het
4930519G04Rik T G 5: 115,012,415 (GRCm39) probably null Het
Ablim2 C T 5: 36,013,510 (GRCm39) Q148* probably null Het
Ap3s2 A T 7: 79,530,234 (GRCm39) *194R probably null Het
Arpp21 C T 9: 111,978,421 (GRCm39) A235T probably benign Het
C9orf72 T C 4: 35,213,556 (GRCm39) D198G probably benign Het
Ccdc33 T C 9: 57,936,078 (GRCm39) D939G probably benign Het
Celsr2 A T 3: 108,320,610 (GRCm39) I734N probably damaging Het
Clcn1 C A 6: 42,277,275 (GRCm39) N455K probably benign Het
Cpne8 C T 15: 90,503,893 (GRCm39) V91I possibly damaging Het
Cstdc7 A G 18: 42,306,727 (GRCm39) probably null Het
Ddx1 A G 12: 13,279,295 (GRCm39) V448A probably damaging Het
Dnhd1 G A 7: 105,352,416 (GRCm39) R2523Q probably damaging Het
Eeig1 G A 2: 32,456,339 (GRCm39) A334T probably damaging Het
Eif2a G T 3: 58,455,933 (GRCm39) D311Y probably damaging Het
Eif2ak4 G A 2: 118,258,419 (GRCm39) E512K probably damaging Het
Gucy1a1 A T 3: 82,016,380 (GRCm39) Y203N probably damaging Het
Hook3 T C 8: 26,562,321 (GRCm39) Q248R probably damaging Het
Ifit2 T A 19: 34,550,937 (GRCm39) V159E possibly damaging Het
Il17rd T C 14: 26,810,024 (GRCm39) V20A possibly damaging Het
Kcnq3 T A 15: 65,897,027 (GRCm39) D291V probably damaging Het
Klf11 A T 12: 24,704,929 (GRCm39) M111L probably benign Het
Lama5 T A 2: 179,836,356 (GRCm39) H1165L probably benign Het
Lmo7 A G 14: 102,139,522 (GRCm39) N702S probably damaging Het
Lta4h T C 10: 93,307,736 (GRCm39) V323A probably damaging Het
Mkrn3 T C 7: 62,068,735 (GRCm39) E352G possibly damaging Het
Ms4a19 T C 19: 11,118,999 (GRCm39) S37G possibly damaging Het
Mtf2 T A 5: 108,242,023 (GRCm39) L277Q probably damaging Het
Myo9b A G 8: 71,775,918 (GRCm39) N370D probably benign Het
Nlrp4e A C 7: 23,036,316 (GRCm39) K723T probably benign Het
Nsun3 A G 16: 62,555,689 (GRCm39) V279A possibly damaging Het
Pde6b A G 5: 108,571,424 (GRCm39) D459G probably benign Het
Phgdh T C 3: 98,235,655 (GRCm39) I121V probably benign Het
Pik3r5 T C 11: 68,386,803 (GRCm39) C811R probably damaging Het
Spaca6 A C 17: 18,051,344 (GRCm39) I27L probably benign Het
Trmt1l G A 1: 151,330,746 (GRCm39) V588I probably benign Het
Tshr A G 12: 91,503,967 (GRCm39) N302D probably damaging Het
Vmn2r23 A G 6: 123,689,961 (GRCm39) D279G probably damaging Het
Wnt3a T C 11: 59,166,106 (GRCm39) N58S probably damaging Het
Zkscan8 A G 13: 21,704,895 (GRCm39) V276A probably damaging Het
Other mutations in Esp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0972:Esp15 UTSW 17 39,953,557 (GRCm39) missense possibly damaging 0.89
R5387:Esp15 UTSW 17 39,955,468 (GRCm39) splice site probably null
R5576:Esp15 UTSW 17 39,953,564 (GRCm39) missense probably damaging 0.98
R7699:Esp15 UTSW 17 39,955,624 (GRCm39) missense possibly damaging 0.67
R9750:Esp15 UTSW 17 39,955,603 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ACATTCCTTACTGCAACTGTTG -3'
(R):5'- CATAGACTTTTGGACACTAGGAGG -3'

Sequencing Primer
(F):5'- GCTGATCTCAACGATGAC -3'
(R):5'- GGCCCTTGAGTGATAATG -3'
Posted On 2016-10-06