Incidental Mutation 'R5528:Ifit2'
ID433556
Institutional Source Beutler Lab
Gene Symbol Ifit2
Ensembl Gene ENSMUSG00000045932
Gene Nameinterferon-induced protein with tetratricopeptide repeats 2
SynonymsIfi54
MMRRC Submission 043086-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R5528 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location34550694-34576419 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34573537 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 159 (V159E)
Ref Sequence ENSEMBL: ENSMUSP00000099890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102826] [ENSMUST00000149829]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102826
AA Change: V159E

PolyPhen 2 Score 0.632 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099890
Gene: ENSMUSG00000045932
AA Change: V159E

DomainStartEndE-ValueType
Pfam:TPR_2 95 127 4e-4 PFAM
Pfam:TPR_8 95 127 3.8e-4 PFAM
Blast:TPR 138 171 7e-11 BLAST
Blast:TPR 172 208 2e-9 BLAST
low complexity region 211 222 N/A INTRINSIC
Pfam:TPR_19 225 286 4e-8 PFAM
low complexity region 396 406 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149829
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susuceptibility to VSV infection with increased lethality and brain viral titer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,066,499 L483P probably benign Het
1700025F22Rik T C 19: 11,141,635 S37G possibly damaging Het
3110043O21Rik T C 4: 35,213,556 D198G probably benign Het
4930519G04Rik T G 5: 114,874,354 probably null Het
Ablim2 C T 5: 35,856,166 Q148* probably null Het
Ap3s2 A T 7: 79,880,486 *194R probably null Het
Arpp21 C T 9: 112,149,353 A235T probably benign Het
Ccdc33 T C 9: 58,028,795 D939G probably benign Het
Celsr2 A T 3: 108,413,294 I734N probably damaging Het
Clcn1 C A 6: 42,300,341 N455K probably benign Het
Cpne8 C T 15: 90,619,690 V91I possibly damaging Het
Ddx1 A G 12: 13,229,294 V448A probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Eif2a G T 3: 58,548,512 D311Y probably damaging Het
Eif2ak4 G A 2: 118,427,938 E512K probably damaging Het
Esp15 A T 17: 39,644,749 Y69F probably benign Het
Fam102a G A 2: 32,566,327 A334T probably damaging Het
Gm5689 A G 18: 42,173,662 probably null Het
Gucy1a1 A T 3: 82,109,073 Y203N probably damaging Het
Hook3 T C 8: 26,072,293 Q248R probably damaging Het
Il17rd T C 14: 27,088,067 V20A possibly damaging Het
Kcnq3 T A 15: 66,025,178 D291V probably damaging Het
Klf11 A T 12: 24,654,930 M111L probably benign Het
Lama5 T A 2: 180,194,563 H1165L probably benign Het
Lmo7 A G 14: 101,902,086 N702S probably damaging Het
Lta4h T C 10: 93,471,874 V323A probably damaging Het
Mkrn3 T C 7: 62,418,987 E352G possibly damaging Het
Mtf2 T A 5: 108,094,157 L277Q probably damaging Het
Myo9b A G 8: 71,323,274 N370D probably benign Het
Nlrp4e A C 7: 23,336,891 K723T probably benign Het
Nsun3 A G 16: 62,735,326 V279A possibly damaging Het
Pde6b A G 5: 108,423,558 D459G probably benign Het
Phgdh T C 3: 98,328,339 I121V probably benign Het
Pik3r5 T C 11: 68,495,977 C811R probably damaging Het
Spaca6 A C 17: 17,831,082 I27L probably benign Het
Trmt1l G A 1: 151,454,995 V588I probably benign Het
Tshr A G 12: 91,537,193 N302D probably damaging Het
Vmn2r23 A G 6: 123,713,002 D279G probably damaging Het
Wnt3a T C 11: 59,275,280 N58S probably damaging Het
Zkscan8 A G 13: 21,520,725 V276A probably damaging Het
Other mutations in Ifit2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ifit2 APN 19 34573302 missense probably damaging 1.00
IGL02261:Ifit2 APN 19 34574224 missense probably damaging 1.00
IGL02375:Ifit2 APN 19 34574337 missense probably benign 0.01
Pushup UTSW 19 34574045 missense probably benign 0.38
R0017:Ifit2 UTSW 19 34573573 missense probably damaging 1.00
R0017:Ifit2 UTSW 19 34573573 missense probably damaging 1.00
R0682:Ifit2 UTSW 19 34573612 missense probably benign 0.13
R0927:Ifit2 UTSW 19 34573584 missense probably benign 0.03
R1462:Ifit2 UTSW 19 34573186 missense probably null 0.12
R1462:Ifit2 UTSW 19 34573186 missense probably null 0.12
R1526:Ifit2 UTSW 19 34573202 missense probably benign 0.00
R2084:Ifit2 UTSW 19 34573350 missense probably damaging 1.00
R3971:Ifit2 UTSW 19 34574041 missense probably benign 0.00
R4008:Ifit2 UTSW 19 34574045 missense probably benign 0.38
R4010:Ifit2 UTSW 19 34574045 missense probably benign 0.38
R4011:Ifit2 UTSW 19 34574045 missense probably benign 0.38
R4359:Ifit2 UTSW 19 34573144 missense possibly damaging 0.85
R5179:Ifit2 UTSW 19 34573576 missense probably damaging 1.00
R5240:Ifit2 UTSW 19 34574396 missense probably benign 0.02
R5424:Ifit2 UTSW 19 34574058 missense probably benign 0.19
R6605:Ifit2 UTSW 19 34573497 nonsense probably null
R7172:Ifit2 UTSW 19 34573494 missense probably benign 0.24
R7424:Ifit2 UTSW 19 34573198 missense probably benign 0.37
R8090:Ifit2 UTSW 19 34573262 missense possibly damaging 0.70
X0023:Ifit2 UTSW 19 34574250 missense possibly damaging 0.59
X0064:Ifit2 UTSW 19 34573923 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGAAATCAGAAGTCTGGTCACC -3'
(R):5'- TACCGCGTCAAGCTTCAGTG -3'

Sequencing Primer
(F):5'- CACCTGGGGAAACTATGCTTG -3'
(R):5'- GCTTCAGTGCCAAGAGGACTTTAAC -3'
Posted On2016-10-06