Incidental Mutation 'R5529:Tbc1d8'
ID 433558
Institutional Source Beutler Lab
Gene Symbol Tbc1d8
Ensembl Gene ENSMUSG00000003134
Gene Name TBC1 domain family, member 8
Synonyms GRAM domain, AD3, HBLP1, BUB2-like protein 1
MMRRC Submission 043087-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5529 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 39371492-39478755 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 39372755 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Serine at position 1000 (Y1000S)
Ref Sequence ENSEMBL: ENSMUSP00000049967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054462] [ENSMUST00000086535] [ENSMUST00000178079] [ENSMUST00000179954] [ENSMUST00000192531] [ENSMUST00000193823] [ENSMUST00000194746] [ENSMUST00000195123]
AlphaFold Q9Z1A9
Predicted Effect probably benign
Transcript: ENSMUST00000054462
AA Change: Y1000S

PolyPhen 2 Score 0.420 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000049967
Gene: ENSMUSG00000003134
AA Change: Y1000S

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
GRAM 145 212 3.6e-20 SMART
GRAM 285 353 2.77e-21 SMART
TBC 501 714 4.51e-54 SMART
Blast:TBC 726 923 1e-120 BLAST
coiled coil region 960 991 N/A INTRINSIC
low complexity region 1030 1045 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086535
SMART Domains Protein: ENSMUSP00000083722
Gene: ENSMUSG00000073702

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:Ribosomal_L31e 18 101 3.1e-43 PFAM
low complexity region 102 113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178079
SMART Domains Protein: ENSMUSP00000136354
Gene: ENSMUSG00000073702

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:Ribosomal_L31e 18 101 3.1e-43 PFAM
low complexity region 102 113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179954
SMART Domains Protein: ENSMUSP00000137631
Gene: ENSMUSG00000073702

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:Ribosomal_L31e 18 101 3.1e-43 PFAM
low complexity region 102 113 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191855
Predicted Effect probably benign
Transcript: ENSMUST00000192099
Predicted Effect probably benign
Transcript: ENSMUST00000192531
SMART Domains Protein: ENSMUSP00000142143
Gene: ENSMUSG00000003134

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
low complexity region 80 98 N/A INTRINSIC
low complexity region 144 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193823
SMART Domains Protein: ENSMUSP00000141750
Gene: ENSMUSG00000003134

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
GRAM 145 212 1.2e-22 SMART
GRAM 285 353 9.6e-24 SMART
TBC 501 714 2.2e-56 SMART
Blast:TBC 726 923 1e-120 BLAST
coiled coil region 960 990 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194746
SMART Domains Protein: ENSMUSP00000141808
Gene: ENSMUSG00000073702

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:Ribosomal_L31e 18 101 3.1e-40 PFAM
low complexity region 102 113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195123
SMART Domains Protein: ENSMUSP00000142039
Gene: ENSMUSG00000073702

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:Ribosomal_L31e 18 83 7.9e-29 PFAM
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 95.7%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,264,881 Y2079C probably damaging Het
Alg2 T C 4: 47,472,101 R236G probably damaging Het
Alpl T A 4: 137,746,422 N323I probably damaging Het
Anxa3 A G 5: 96,828,379 E172G probably benign Het
Atp8a2 A G 14: 59,793,865 probably null Het
Cadps T C 14: 12,454,285 K1078E probably damaging Het
Ces2e G T 8: 104,929,911 V258L probably benign Het
Daam2 A G 17: 49,459,057 F1041S probably benign Het
Dcstamp A G 15: 39,754,536 I114V probably benign Het
Ddhd2 C T 8: 25,739,560 R496Q probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Eml6 T A 11: 29,764,126 R1335S probably benign Het
F12 T C 13: 55,422,059 N102S probably benign Het
Fbn1 G A 2: 125,373,950 L712F probably benign Het
Fgf1 G T 18: 38,858,604 F37L probably damaging Het
Fgf14 T A 14: 123,980,455 H212L probably damaging Het
Gm10036 A T 18: 15,832,801 Q3L probably benign Het
Hivep1 T C 13: 42,156,650 F789L possibly damaging Het
Hspg2 C A 4: 137,551,828 T3074N probably damaging Het
Katnb1 C T 8: 95,097,672 R495C probably damaging Het
Kdm5b C T 1: 134,588,003 H122Y probably damaging Het
Ky C T 9: 102,542,075 S427L probably benign Het
Med9 T G 11: 59,960,660 V105G probably benign Het
Ndufa11 T A 17: 56,721,059 V43D probably damaging Het
Nlrp4b T A 7: 10,714,946 C359S possibly damaging Het
Olfr361 T A 2: 37,084,909 I280F possibly damaging Het
Olfr558 A T 7: 102,709,693 K145* probably null Het
Paxbp1 T A 16: 91,030,513 Y478F possibly damaging Het
Pole G A 5: 110,332,466 E92K probably benign Het
Prom1 G T 5: 44,026,768 L449M probably damaging Het
Psg28 G A 7: 18,430,448 T113I probably benign Het
Reln A C 5: 21,932,715 V2493G possibly damaging Het
Rp1 C T 1: 4,345,832 V1686I probably benign Het
Setbp1 T C 18: 79,086,652 I122V probably damaging Het
Setd5 T C 6: 113,121,568 Y721H probably damaging Het
Shroom1 T C 11: 53,463,922 F223S probably damaging Het
Son T A 16: 91,655,466 L367Q probably damaging Het
Spred2 G T 11: 20,021,301 D363Y probably damaging Het
Tdp2 A T 13: 24,838,236 K213* probably null Het
Tmem89 T C 9: 108,915,477 I146T probably damaging Het
Vhl T C 6: 113,629,463 V147A probably benign Het
Vmn2r23 C T 6: 123,713,451 L429F probably benign Het
Vrk2 T C 11: 26,499,036 D186G probably damaging Het
Wisp2 T C 2: 163,825,359 probably null Het
Zbtb40 A G 4: 136,983,163 F1222L possibly damaging Het
Zfp266 A G 9: 20,506,734 S7P probably damaging Het
Zfp472 T A 17: 32,978,433 I494K possibly damaging Het
Zfp655 A G 5: 145,244,736 E468G probably damaging Het
Other mutations in Tbc1d8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Tbc1d8 APN 1 39394129 missense probably damaging 0.96
IGL01501:Tbc1d8 APN 1 39389335 missense probably damaging 1.00
IGL01548:Tbc1d8 APN 1 39381304 missense probably damaging 0.96
IGL01884:Tbc1d8 APN 1 39376445 missense probably damaging 1.00
IGL01919:Tbc1d8 APN 1 39392253 missense probably damaging 1.00
IGL02123:Tbc1d8 APN 1 39376907 missense possibly damaging 0.54
IGL02123:Tbc1d8 APN 1 39380236 missense probably damaging 0.98
IGL02135:Tbc1d8 APN 1 39402810 missense probably damaging 1.00
IGL02317:Tbc1d8 APN 1 39376904 missense probably benign 0.00
IGL02325:Tbc1d8 APN 1 39394240 missense probably damaging 0.99
IGL02607:Tbc1d8 APN 1 39379511 missense probably benign 0.05
R0533:Tbc1d8 UTSW 1 39372774 missense possibly damaging 0.82
R0604:Tbc1d8 UTSW 1 39405326 missense probably damaging 1.00
R0612:Tbc1d8 UTSW 1 39372515 missense possibly damaging 0.92
R0639:Tbc1d8 UTSW 1 39391209 missense probably benign 0.00
R0976:Tbc1d8 UTSW 1 39406801 missense probably damaging 1.00
R1051:Tbc1d8 UTSW 1 39381453 nonsense probably null
R1605:Tbc1d8 UTSW 1 39391125 missense probably benign 0.38
R1622:Tbc1d8 UTSW 1 39380236 missense probably benign 0.00
R1710:Tbc1d8 UTSW 1 39406837 missense possibly damaging 0.89
R2419:Tbc1d8 UTSW 1 39376902 missense probably damaging 1.00
R2437:Tbc1d8 UTSW 1 39405287 splice site probably null
R2862:Tbc1d8 UTSW 1 39402696 nonsense probably null
R2870:Tbc1d8 UTSW 1 39405317 missense probably damaging 1.00
R2870:Tbc1d8 UTSW 1 39405317 missense probably damaging 1.00
R2872:Tbc1d8 UTSW 1 39405317 missense probably damaging 1.00
R2872:Tbc1d8 UTSW 1 39405317 missense probably damaging 1.00
R2873:Tbc1d8 UTSW 1 39405317 missense probably damaging 1.00
R2874:Tbc1d8 UTSW 1 39405317 missense probably damaging 1.00
R3759:Tbc1d8 UTSW 1 39376465 missense probably damaging 1.00
R4127:Tbc1d8 UTSW 1 39372431 missense probably benign 0.05
R4154:Tbc1d8 UTSW 1 39386135 missense probably damaging 0.99
R4613:Tbc1d8 UTSW 1 39372708 missense probably damaging 0.98
R4737:Tbc1d8 UTSW 1 39402878 missense possibly damaging 0.63
R4738:Tbc1d8 UTSW 1 39402878 missense possibly damaging 0.63
R4739:Tbc1d8 UTSW 1 39402878 missense possibly damaging 0.63
R4740:Tbc1d8 UTSW 1 39402878 missense possibly damaging 0.63
R5189:Tbc1d8 UTSW 1 39385132 missense probably benign 0.00
R5271:Tbc1d8 UTSW 1 39373767 missense probably damaging 0.97
R5308:Tbc1d8 UTSW 1 39389409 missense probably damaging 1.00
R5393:Tbc1d8 UTSW 1 39426088 missense probably damaging 0.99
R5897:Tbc1d8 UTSW 1 39392109 missense possibly damaging 0.95
R6160:Tbc1d8 UTSW 1 39372403 missense probably damaging 0.98
R6408:Tbc1d8 UTSW 1 39402899 missense probably damaging 0.99
R6409:Tbc1d8 UTSW 1 39372588 missense probably benign 0.00
R6554:Tbc1d8 UTSW 1 39406822 missense probably damaging 1.00
R6841:Tbc1d8 UTSW 1 39389374 missense possibly damaging 0.68
R7282:Tbc1d8 UTSW 1 39372533 missense probably benign 0.00
R7294:Tbc1d8 UTSW 1 39406762 missense probably damaging 1.00
R7384:Tbc1d8 UTSW 1 39394098 missense probably benign 0.00
R7718:Tbc1d8 UTSW 1 39376980 missense probably benign 0.00
R7881:Tbc1d8 UTSW 1 39386023 missense probably damaging 0.98
R7918:Tbc1d8 UTSW 1 39402728 missense probably damaging 1.00
R7972:Tbc1d8 UTSW 1 39392169 missense probably damaging 1.00
R8269:Tbc1d8 UTSW 1 39426088 missense probably benign 0.00
R8352:Tbc1d8 UTSW 1 39405357 missense probably damaging 1.00
R8425:Tbc1d8 UTSW 1 39381409 missense probably damaging 1.00
R8452:Tbc1d8 UTSW 1 39405357 missense probably damaging 1.00
R9159:Tbc1d8 UTSW 1 39405393 missense
Predicted Primers PCR Primer
(F):5'- AAACTGAGTCCTGTTCGGGAG -3'
(R):5'- ACCCTTTCTAAATATGCTGCTTGTG -3'

Sequencing Primer
(F):5'- TGTTCGGGAGGAGCCGAG -3'
(R):5'- TGGGACACAACTATCACCCAGTG -3'
Posted On 2016-10-06