Mutagenetix > Incidental Mutations

Incidental Mutation 'R5529:Kdm5b'

433559

Institutional Source

Beutler Lab

Gene Symbol

Kdm5b

Ensembl Gene

ENSMUSG00000042207

Gene Name

lysine (K)-specific demethylase 5B

Synonyms

Jarid1b, Plu1, Rb-Bp2, 2210016I17Rik, 2010009J12Rik, PLU-1, D1Ertd202e

MMRRC Submission

043087-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.452) question?

Stock #

R5529 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

134560171-134635285 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 134588003 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 122 (H122Y)

Ref Sequence

ENSEMBL: ENSMUSP00000107817 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]

AlphaFold

Q80Y84

PDB Structure

Solution structure of the ARID domain of Jarid1b protein [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000047714
AA Change: H122Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207
AA Change: H122Y

Domain	Start	End	E-Value	Type
low complexity region	7	30	N/A	INTRINSIC
JmjN	31	72	2.87e-20	SMART
ARID	94	183	7.39e-32	SMART
BRIGHT	98	188	1.51e-35	SMART
low complexity region	228	239	N/A	INTRINSIC
PHD	311	357	6.15e-14	SMART
JmjC	453	619	2.33e-67	SMART
Pfam:zf-C5HC2	692	744	2.2e-17	PFAM
Pfam:PLU-1	757	1088	5.6e-92	PFAM
low complexity region	1097	1109	N/A	INTRINSIC
PHD	1178	1222	6.2e-10	SMART
low complexity region	1225	1236	N/A	INTRINSIC
low complexity region	1406	1417	N/A	INTRINSIC
low complexity region	1470	1484	N/A	INTRINSIC
PHD	1486	1536	1.18e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000112197

SMART Domains

Protein: ENSMUSP00000107816
Gene: ENSMUSG00000042207

Domain	Start	End	E-Value	Type
low complexity region	7	30	N/A	INTRINSIC
JmjN	31	72	2.87e-20	SMART
ARID	94	183	7.39e-32	SMART
BRIGHT	98	188	1.51e-35	SMART
low complexity region	225	236	N/A	INTRINSIC
PHD	308	354	6.15e-14	SMART
JmjC	450	595	2.6e-24	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112198
AA Change: H122Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207
AA Change: H122Y

Domain	Start	End	E-Value	Type
low complexity region	7	30	N/A	INTRINSIC
JmjN	31	72	2.87e-20	SMART
ARID	94	183	7.39e-32	SMART
BRIGHT	98	188	1.51e-35	SMART
low complexity region	228	239	N/A	INTRINSIC
PHD	311	357	6.15e-14	SMART
JmjC	453	619	2.33e-67	SMART
Pfam:zf-C5HC2	692	745	6.7e-21	PFAM
Pfam:PLU-1	756	1088	6e-94	PFAM
low complexity region	1097	1109	N/A	INTRINSIC
PHD	1178	1222	6.2e-10	SMART
low complexity region	1225	1236	N/A	INTRINSIC
low complexity region	1406	1417	N/A	INTRINSIC
low complexity region	1470	1484	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186128

Coding Region Coverage

1x: 98.7%
3x: 97.5%
10x: 95.7%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	C	1: 71,264,881	Y2079C	probably damaging	Het
Alg2	T	C	4: 47,472,101	R236G	probably damaging	Het
Alpl	T	A	4: 137,746,422	N323I	probably damaging	Het
Anxa3	A	G	5: 96,828,379	E172G	probably benign	Het
Atp8a2	A	G	14: 59,793,865		probably null	Het
Cadps	T	C	14: 12,454,285	K1078E	probably damaging	Het
Ces2e	G	T	8: 104,929,911	V258L	probably benign	Het
Daam2	A	G	17: 49,459,057	F1041S	probably benign	Het
Dcstamp	A	G	15: 39,754,536	I114V	probably benign	Het
Ddhd2	C	T	8: 25,739,560	R496Q	probably benign	Het
Dnhd1	G	A	7: 105,703,209	R2523Q	probably damaging	Het
Eml6	T	A	11: 29,764,126	R1335S	probably benign	Het
F12	T	C	13: 55,422,059	N102S	probably benign	Het
Fbn1	G	A	2: 125,373,950	L712F	probably benign	Het
Fgf1	G	T	18: 38,858,604	F37L	probably damaging	Het
Fgf14	T	A	14: 123,980,455	H212L	probably damaging	Het
Gm10036	A	T	18: 15,832,801	Q3L	probably benign	Het
Hivep1	T	C	13: 42,156,650	F789L	possibly damaging	Het
Hspg2	C	A	4: 137,551,828	T3074N	probably damaging	Het
Katnb1	C	T	8: 95,097,672	R495C	probably damaging	Het
Ky	C	T	9: 102,542,075	S427L	probably benign	Het
Med9	T	G	11: 59,960,660	V105G	probably benign	Het
Ndufa11	T	A	17: 56,721,059	V43D	probably damaging	Het
Nlrp4b	T	A	7: 10,714,946	C359S	possibly damaging	Het
Olfr361	T	A	2: 37,084,909	I280F	possibly damaging	Het
Olfr558	A	T	7: 102,709,693	K145*	probably null	Het
Paxbp1	T	A	16: 91,030,513	Y478F	possibly damaging	Het
Pole	G	A	5: 110,332,466	E92K	probably benign	Het
Prom1	G	T	5: 44,026,768	L449M	probably damaging	Het
Psg28	G	A	7: 18,430,448	T113I	probably benign	Het
Reln	A	C	5: 21,932,715	V2493G	possibly damaging	Het
Rp1	C	T	1: 4,345,832	V1686I	probably benign	Het
Setbp1	T	C	18: 79,086,652	I122V	probably damaging	Het
Setd5	T	C	6: 113,121,568	Y721H	probably damaging	Het
Shroom1	T	C	11: 53,463,922	F223S	probably damaging	Het
Son	T	A	16: 91,655,466	L367Q	probably damaging	Het
Spred2	G	T	11: 20,021,301	D363Y	probably damaging	Het
Tbc1d8	T	G	1: 39,372,755	Y1000S	probably benign	Het
Tdp2	A	T	13: 24,838,236	K213*	probably null	Het
Tmem89	T	C	9: 108,915,477	I146T	probably damaging	Het
Vhl	T	C	6: 113,629,463	V147A	probably benign	Het
Vmn2r23	C	T	6: 123,713,451	L429F	probably benign	Het
Vrk2	T	C	11: 26,499,036	D186G	probably damaging	Het
Wisp2	T	C	2: 163,825,359		probably null	Het
Zbtb40	A	G	4: 136,983,163	F1222L	possibly damaging	Het
Zfp266	A	G	9: 20,506,734	S7P	probably damaging	Het
Zfp472	T	A	17: 32,978,433	I494K	possibly damaging	Het
Zfp655	A	G	5: 145,244,736	E468G	probably damaging	Het

Other mutations in Kdm5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Kdm5b	APN	1	134620955	missense	probably damaging	1.00
IGL01458:Kdm5b	APN	1	134621986	missense	possibly damaging	0.53
IGL01567:Kdm5b	APN	1	134602540	missense	probably damaging	1.00
IGL01625:Kdm5b	APN	1	134617968	missense	possibly damaging	0.74
IGL01970:Kdm5b	APN	1	134600727	missense	probably damaging	1.00
IGL02183:Kdm5b	APN	1	134624931	missense	probably benign	0.09
IGL02592:Kdm5b	APN	1	134624853	missense	probably damaging	0.99
IGL02695:Kdm5b	APN	1	134604485	missense	possibly damaging	0.94
IGL02697:Kdm5b	APN	1	134588773	splice site	probably benign
IGL03036:Kdm5b	APN	1	134608937	missense	probably damaging	1.00
IGL03056:Kdm5b	APN	1	134587979	missense	probably damaging	0.99
IGL03206:Kdm5b	APN	1	134627317	missense	probably benign
IGL03342:Kdm5b	APN	1	134602576	missense	probably benign	0.00
IGL03388:Kdm5b	APN	1	134627322	missense	probably benign
amaryllis	UTSW	1	134609061	critical splice donor site	probably null
PIT4486001:Kdm5b	UTSW	1	134628685	missense	probably damaging	1.00
R0233:Kdm5b	UTSW	1	134604634	splice site	probably benign
R0334:Kdm5b	UTSW	1	134604522	missense	probably damaging	0.99
R0504:Kdm5b	UTSW	1	134621023	critical splice donor site	probably null
R0505:Kdm5b	UTSW	1	134602571	missense	probably damaging	0.96
R0521:Kdm5b	UTSW	1	134618033	missense	possibly damaging	0.65
R1004:Kdm5b	UTSW	1	134588904	missense	possibly damaging	0.71
R1087:Kdm5b	UTSW	1	134600637	missense	probably damaging	1.00
R1126:Kdm5b	UTSW	1	134613991	missense	possibly damaging	0.90
R1221:Kdm5b	UTSW	1	134599091	missense	probably damaging	0.98
R1230:Kdm5b	UTSW	1	134613254	missense	probably damaging	1.00
R1345:Kdm5b	UTSW	1	134630550	missense	possibly damaging	0.94
R1482:Kdm5b	UTSW	1	134624897	missense	probably damaging	1.00
R1582:Kdm5b	UTSW	1	134624853	missense	probably damaging	0.99
R1653:Kdm5b	UTSW	1	134602481	missense	probably damaging	1.00
R1693:Kdm5b	UTSW	1	134597576	splice site	probably benign
R1721:Kdm5b	UTSW	1	134613181	splice site	probably benign
R1741:Kdm5b	UTSW	1	134618017	missense	possibly damaging	0.82
R1762:Kdm5b	UTSW	1	134604467	nonsense	probably null
R1820:Kdm5b	UTSW	1	134597670	missense	possibly damaging	0.87
R1872:Kdm5b	UTSW	1	134624994	missense	probably damaging	1.00
R1966:Kdm5b	UTSW	1	134613873	splice site	probably null
R2056:Kdm5b	UTSW	1	134613214	missense	probably benign	0.05
R2059:Kdm5b	UTSW	1	134613214	missense	probably benign	0.05
R2405:Kdm5b	UTSW	1	134609016	missense	probably damaging	0.97
R3417:Kdm5b	UTSW	1	134587977	missense	probably damaging	1.00
R3771:Kdm5b	UTSW	1	134613345	missense	probably damaging	1.00
R3783:Kdm5b	UTSW	1	134630542	missense	probably benign
R3803:Kdm5b	UTSW	1	134615941	missense	probably benign	0.07
R3980:Kdm5b	UTSW	1	134619670	missense	probably benign	0.11
R3983:Kdm5b	UTSW	1	134631304	missense	possibly damaging	0.91
R4013:Kdm5b	UTSW	1	134627329	missense	possibly damaging	0.86
R4162:Kdm5b	UTSW	1	134625161	missense	probably benign	0.01
R4701:Kdm5b	UTSW	1	134606012	intron	probably benign
R4791:Kdm5b	UTSW	1	134630800	missense	possibly damaging	0.82
R4836:Kdm5b	UTSW	1	134593315	splice site	probably null
R4924:Kdm5b	UTSW	1	134631351	missense	probably benign	0.00
R5135:Kdm5b	UTSW	1	134588746	intron	probably benign
R5248:Kdm5b	UTSW	1	134620997	missense	probably benign	0.11
R5290:Kdm5b	UTSW	1	134622099	splice site	probably null
R5358:Kdm5b	UTSW	1	134607694	nonsense	probably null
R5388:Kdm5b	UTSW	1	134608897	nonsense	probably null
R5396:Kdm5b	UTSW	1	134622098	splice site	probably null
R5397:Kdm5b	UTSW	1	134622098	splice site	probably null
R5398:Kdm5b	UTSW	1	134622098	splice site	probably null
R5399:Kdm5b	UTSW	1	134622098	splice site	probably null
R5540:Kdm5b	UTSW	1	134631241	missense	probably damaging	0.98
R5661:Kdm5b	UTSW	1	134599073	missense	probably benign	0.01
R5663:Kdm5b	UTSW	1	134630635	missense	probably benign
R5822:Kdm5b	UTSW	1	134588773	splice site	probably benign
R6226:Kdm5b	UTSW	1	134608878	missense	probably damaging	0.99
R6368:Kdm5b	UTSW	1	134599207	missense	probably damaging	1.00
R6681:Kdm5b	UTSW	1	134613269	missense	possibly damaging	0.90
R6715:Kdm5b	UTSW	1	134609061	critical splice donor site	probably null
R7132:Kdm5b	UTSW	1	134599106	missense	probably damaging	1.00
R7202:Kdm5b	UTSW	1	134624759	missense	probably benign
R7258:Kdm5b	UTSW	1	134621021	missense	probably damaging	1.00
R7335:Kdm5b	UTSW	1	134560439	missense	probably damaging	1.00
R7420:Kdm5b	UTSW	1	134604497	missense	probably benign	0.14
R7426:Kdm5b	UTSW	1	134595833	missense	probably benign	0.02
R7452:Kdm5b	UTSW	1	134624948	missense	probably damaging	1.00
R7595:Kdm5b	UTSW	1	134608966	missense	probably benign	0.00
R7612:Kdm5b	UTSW	1	134624918	nonsense	probably null
R7704:Kdm5b	UTSW	1	134587931	missense	probably damaging	1.00
R7846:Kdm5b	UTSW	1	134617840	missense	probably damaging	1.00
R8115:Kdm5b	UTSW	1	134619673	missense	possibly damaging	0.83
R8146:Kdm5b	UTSW	1	134625126	missense	probably benign	0.05
R8160:Kdm5b	UTSW	1	134613919	missense	probably damaging	1.00
R8527:Kdm5b	UTSW	1	134605774	missense	possibly damaging	0.78
R8542:Kdm5b	UTSW	1	134605774	missense	possibly damaging	0.78
R8930:Kdm5b	UTSW	1	134616272	missense	probably damaging	1.00
R8932:Kdm5b	UTSW	1	134616272	missense	probably damaging	1.00
R8950:Kdm5b	UTSW	1	134613926	missense	possibly damaging	0.84
R9089:Kdm5b	UTSW	1	134607768	missense	probably damaging	0.98
R9109:Kdm5b	UTSW	1	134600755	critical splice donor site	probably null
R9133:Kdm5b	UTSW	1	134602585	missense	probably benign
R9298:Kdm5b	UTSW	1	134600755	critical splice donor site	probably null
R9423:Kdm5b	UTSW	1	134587967	missense	not run
X0063:Kdm5b	UTSW	1	134588876	missense	probably benign	0.07
Z1176:Kdm5b	UTSW	1	134625035	missense	probably damaging	1.00
Z1177:Kdm5b	UTSW	1	134595798	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TGCCAGCAGTGTAACCTCTC -3'
(R):5'- GGACCCTTTGCAGTGAAAGATAAATTG -3'

Sequencing Primer
(F):5'- GCAGTGTAACCTCTCCCCCAC -3'
(R):5'- GCTTACAAACTACATAGGTAAAGCTC -3'

Posted On

2016-10-06