Incidental Mutation 'R5529:Olfr361'
ID 433560
Institutional Source Beutler Lab
Gene Symbol Olfr361
Ensembl Gene ENSMUSG00000075378
Gene Name olfactory receptor 361
Synonyms GA_x6K02T2NLDC-33777519-33776551, MOR159-3
MMRRC Submission 043087-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock # R5529 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 37083736-37089290 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37084909 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 280 (I280F)
Ref Sequence ENSEMBL: ENSMUSP00000149770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100145] [ENSMUST00000214969] [ENSMUST00000216663]
AlphaFold Q8VF16
Predicted Effect possibly damaging
Transcript: ENSMUST00000100145
AA Change: I280F

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097723
Gene: ENSMUSG00000075378
AA Change: I280F

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.5e-44 PFAM
Pfam:7tm_1 41 289 2.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126779
Predicted Effect possibly damaging
Transcript: ENSMUST00000214969
AA Change: I280F

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216663
AA Change: I280F

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 95.7%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,264,881 Y2079C probably damaging Het
Alg2 T C 4: 47,472,101 R236G probably damaging Het
Alpl T A 4: 137,746,422 N323I probably damaging Het
Anxa3 A G 5: 96,828,379 E172G probably benign Het
Atp8a2 A G 14: 59,793,865 probably null Het
Cadps T C 14: 12,454,285 K1078E probably damaging Het
Ces2e G T 8: 104,929,911 V258L probably benign Het
Daam2 A G 17: 49,459,057 F1041S probably benign Het
Dcstamp A G 15: 39,754,536 I114V probably benign Het
Ddhd2 C T 8: 25,739,560 R496Q probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Eml6 T A 11: 29,764,126 R1335S probably benign Het
F12 T C 13: 55,422,059 N102S probably benign Het
Fbn1 G A 2: 125,373,950 L712F probably benign Het
Fgf1 G T 18: 38,858,604 F37L probably damaging Het
Fgf14 T A 14: 123,980,455 H212L probably damaging Het
Gm10036 A T 18: 15,832,801 Q3L probably benign Het
Hivep1 T C 13: 42,156,650 F789L possibly damaging Het
Hspg2 C A 4: 137,551,828 T3074N probably damaging Het
Katnb1 C T 8: 95,097,672 R495C probably damaging Het
Kdm5b C T 1: 134,588,003 H122Y probably damaging Het
Ky C T 9: 102,542,075 S427L probably benign Het
Med9 T G 11: 59,960,660 V105G probably benign Het
Ndufa11 T A 17: 56,721,059 V43D probably damaging Het
Nlrp4b T A 7: 10,714,946 C359S possibly damaging Het
Olfr558 A T 7: 102,709,693 K145* probably null Het
Paxbp1 T A 16: 91,030,513 Y478F possibly damaging Het
Pole G A 5: 110,332,466 E92K probably benign Het
Prom1 G T 5: 44,026,768 L449M probably damaging Het
Psg28 G A 7: 18,430,448 T113I probably benign Het
Reln A C 5: 21,932,715 V2493G possibly damaging Het
Rp1 C T 1: 4,345,832 V1686I probably benign Het
Setbp1 T C 18: 79,086,652 I122V probably damaging Het
Setd5 T C 6: 113,121,568 Y721H probably damaging Het
Shroom1 T C 11: 53,463,922 F223S probably damaging Het
Son T A 16: 91,655,466 L367Q probably damaging Het
Spred2 G T 11: 20,021,301 D363Y probably damaging Het
Tbc1d8 T G 1: 39,372,755 Y1000S probably benign Het
Tdp2 A T 13: 24,838,236 K213* probably null Het
Tmem89 T C 9: 108,915,477 I146T probably damaging Het
Vhl T C 6: 113,629,463 V147A probably benign Het
Vmn2r23 C T 6: 123,713,451 L429F probably benign Het
Vrk2 T C 11: 26,499,036 D186G probably damaging Het
Wisp2 T C 2: 163,825,359 probably null Het
Zbtb40 A G 4: 136,983,163 F1222L possibly damaging Het
Zfp266 A G 9: 20,506,734 S7P probably damaging Het
Zfp472 T A 17: 32,978,433 I494K possibly damaging Het
Zfp655 A G 5: 145,244,736 E468G probably damaging Het
Other mutations in Olfr361
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Olfr361 APN 2 37085395 missense possibly damaging 0.94
IGL02210:Olfr361 APN 2 37085619 missense possibly damaging 0.54
IGL03180:Olfr361 APN 2 37085710 missense possibly damaging 0.58
R0571:Olfr361 UTSW 2 37085334 missense probably benign 0.00
R1715:Olfr361 UTSW 2 37085176 missense probably damaging 1.00
R1853:Olfr361 UTSW 2 37085220 missense probably damaging 1.00
R2403:Olfr361 UTSW 2 37084974 missense probably benign 0.34
R3009:Olfr361 UTSW 2 37085077 missense probably benign 0.00
R3713:Olfr361 UTSW 2 37085505 missense possibly damaging 0.73
R4355:Olfr361 UTSW 2 37084930 missense probably benign 0.44
R4476:Olfr361 UTSW 2 37085061 missense probably damaging 1.00
R5191:Olfr361 UTSW 2 37084978 missense probably benign 0.00
R5387:Olfr361 UTSW 2 37085719 missense possibly damaging 0.58
R5891:Olfr361 UTSW 2 37084978 missense probably benign 0.00
R7078:Olfr361 UTSW 2 37085596 missense possibly damaging 0.93
R7208:Olfr361 UTSW 2 37085658 missense probably benign 0.26
R7793:Olfr361 UTSW 2 37084921 missense possibly damaging 0.81
R8007:Olfr361 UTSW 2 37084843 missense probably damaging 1.00
R8843:Olfr361 UTSW 2 37085295 missense probably damaging 1.00
R8970:Olfr361 UTSW 2 37085466 missense probably benign 0.00
R9155:Olfr361 UTSW 2 37085004 missense probably benign 0.01
Z1176:Olfr361 UTSW 2 37085636 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTATCTGCAGTGTTTTCAGAC -3'
(R):5'- TGGTGGTAAGCCCCATTTTC -3'

Sequencing Primer
(F):5'- GACTAACCCTTGCCTCTCAGGAG -3'
(R):5'- CGCATAGGTATTGTTATAGCCCAC -3'
Posted On 2016-10-06