Incidental Mutation 'R5529:Anxa3'
ID433571
Institutional Source Beutler Lab
Gene Symbol Anxa3
Ensembl Gene ENSMUSG00000029484
Gene Nameannexin A3
SynonymsAnx3
MMRRC Submission 043087-MU
Accession Numbers

Genbank: NM_013470; MGI: 1201378; Ensembl: ENSMUST00000112985

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5529 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location96793339-96845966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96828379 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 172 (E172G)
Ref Sequence ENSEMBL: ENSMUSP00000031447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031447] [ENSMUST00000198631] [ENSMUST00000200379]
Predicted Effect probably benign
Transcript: ENSMUST00000031447
AA Change: E172G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031447
Gene: ENSMUSG00000029484
AA Change: E172G

DomainStartEndE-ValueType
ANX 35 87 5.74e-24 SMART
ANX 107 159 1.67e-25 SMART
ANX 191 243 3.67e-22 SMART
ANX 266 318 2.87e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197339
Predicted Effect probably benign
Transcript: ENSMUST00000198631
SMART Domains Protein: ENSMUSP00000143491
Gene: ENSMUSG00000029484

DomainStartEndE-ValueType
ANX 35 87 5.74e-24 SMART
ANX 107 159 1.67e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199656
Predicted Effect probably benign
Transcript: ENSMUST00000200379
SMART Domains Protein: ENSMUSP00000142527
Gene: ENSMUSG00000029484

DomainStartEndE-ValueType
ANX 24 76 7.2e-28 SMART
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 95.7%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the annexin family. Members of this calcium-dependent phospholipid-binding protein family play a role in the regulation of cellular growth and in signal transduction pathways. This protein functions in the inhibition of phopholipase A2 and cleavage of inositol 1,2-cyclic phosphate to form inositol 1-phosphate. This protein may also play a role in anti-coagulation. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,264,881 Y2079C probably damaging Het
Alg2 T C 4: 47,472,101 R236G probably damaging Het
Alpl T A 4: 137,746,422 N323I probably damaging Het
Atp8a2 A G 14: 59,793,865 probably null Het
Cadps T C 14: 12,454,285 K1078E probably damaging Het
Ces2e G T 8: 104,929,911 V258L probably benign Het
Daam2 A G 17: 49,459,057 F1041S probably benign Het
Dcstamp A G 15: 39,754,536 I114V probably benign Het
Ddhd2 C T 8: 25,739,560 R496Q probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Eml6 T A 11: 29,764,126 R1335S probably benign Het
F12 T C 13: 55,422,059 N102S probably benign Het
Fbn1 G A 2: 125,373,950 L712F probably benign Het
Fgf1 G T 18: 38,858,604 F37L probably damaging Het
Fgf14 T A 14: 123,980,455 H212L probably damaging Het
Gm10036 A T 18: 15,832,801 Q3L probably benign Het
Hivep1 T C 13: 42,156,650 F789L possibly damaging Het
Hspg2 C A 4: 137,551,828 T3074N probably damaging Het
Katnb1 C T 8: 95,097,672 R495C probably damaging Het
Kdm5b C T 1: 134,588,003 H122Y probably damaging Het
Ky C T 9: 102,542,075 S427L probably benign Het
Med9 T G 11: 59,960,660 V105G probably benign Het
Ndufa11 T A 17: 56,721,059 V43D probably damaging Het
Nlrp4b T A 7: 10,714,946 C359S possibly damaging Het
Olfr361 T A 2: 37,084,909 I280F possibly damaging Het
Olfr558 A T 7: 102,709,693 K145* probably null Het
Paxbp1 T A 16: 91,030,513 Y478F possibly damaging Het
Pole G A 5: 110,332,466 E92K probably benign Het
Prom1 G T 5: 44,026,768 L449M probably damaging Het
Psg28 G A 7: 18,430,448 T113I probably benign Het
Reln A C 5: 21,932,715 V2493G possibly damaging Het
Rp1 C T 1: 4,345,832 V1686I probably benign Het
Setbp1 T C 18: 79,086,652 I122V probably damaging Het
Setd5 T C 6: 113,121,568 Y721H probably damaging Het
Shroom1 T C 11: 53,463,922 F223S probably damaging Het
Son T A 16: 91,655,466 L367Q probably damaging Het
Spred2 G T 11: 20,021,301 D363Y probably damaging Het
Tbc1d8 T G 1: 39,372,755 Y1000S probably benign Het
Tdp2 A T 13: 24,838,236 K213* probably null Het
Tmem89 T C 9: 108,915,477 I146T probably damaging Het
Vhl T C 6: 113,629,463 V147A probably benign Het
Vmn2r23 C T 6: 123,713,451 L429F probably benign Het
Vrk2 T C 11: 26,499,036 D186G probably damaging Het
Wisp2 T C 2: 163,825,359 probably null Het
Zbtb40 A G 4: 136,983,163 F1222L possibly damaging Het
Zfp266 A G 9: 20,506,734 S7P probably damaging Het
Zfp472 T A 17: 32,978,433 I494K possibly damaging Het
Zfp655 A G 5: 145,244,736 E468G probably damaging Het
Other mutations in Anxa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01984:Anxa3 APN 5 96834771 splice site probably benign
IGL03243:Anxa3 APN 5 96828692 unclassified probably benign
F6893:Anxa3 UTSW 5 96824994 unclassified probably benign
R0026:Anxa3 UTSW 5 96838401 missense probably benign 0.01
R0468:Anxa3 UTSW 5 96811099 missense probably benign 0.00
R0562:Anxa3 UTSW 5 96812884 missense possibly damaging 0.90
R0724:Anxa3 UTSW 5 96828748 missense possibly damaging 0.70
R1442:Anxa3 UTSW 5 96828690 splice site probably null
R2276:Anxa3 UTSW 5 96830490 critical splice donor site probably null
R4922:Anxa3 UTSW 5 96820429 missense probably damaging 1.00
R5108:Anxa3 UTSW 5 96830414 missense possibly damaging 0.83
R5230:Anxa3 UTSW 5 96838312 missense possibly damaging 0.47
R5733:Anxa3 UTSW 5 96820472 missense probably damaging 1.00
R5857:Anxa3 UTSW 5 96828792 critical splice donor site probably null
R5902:Anxa3 UTSW 5 96812853 nonsense probably null
R6558:Anxa3 UTSW 5 96812939 splice site probably null
R6772:Anxa3 UTSW 5 96811113 missense probably damaging 0.98
R7425:Anxa3 UTSW 5 96834821 missense probably benign 0.30
R7515:Anxa3 UTSW 5 96838320 missense probably damaging 1.00
R7619:Anxa3 UTSW 5 96830404 missense probably damaging 1.00
R8018:Anxa3 UTSW 5 96820429 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGACTATCGATGGCAGAGAC -3'
(R):5'- AGGCCAATCAAATCTGAAGGTC -3'

Sequencing Primer
(F):5'- CTATCGATGGCAGAGACAGACTC -3'
(R):5'- TCAAATCTGAAGGTCAAATACAGGAC -3'
Posted On2016-10-06