Mutagenetix > Incidental Mutations

Incidental Mutation 'R5529:Zfp655'

433574

Institutional Source

Beutler Lab

Gene Symbol

Zfp655

Ensembl Gene

ENSMUSG00000007812

Gene Name

zinc finger protein 655

Synonyms

9030409O18Rik, 2700038I16Rik

MMRRC Submission

043087-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.332) question?

Stock #

R5529 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

145231715-145247302 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 145244736 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 468 (E468G)

Ref Sequence

ENSEMBL: ENSMUSP00000128969 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167316] [ENSMUST00000199322]

Predicted Effect

probably damaging
Transcript: ENSMUST00000167316
AA Change: E468G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000128969
Gene: ENSMUSG00000007812
AA Change: E468G

Domain	Start	End	E-Value	Type
ZnF_C2H2	243	265	5.29e-5	SMART
ZnF_C2H2	271	293	2.99e-4	SMART
ZnF_C2H2	299	328	1.38e2	SMART
ZnF_C2H2	334	356	6.78e-3	SMART
ZnF_C2H2	361	383	3.99e0	SMART
ZnF_C2H2	411	433	3.63e-3	SMART
ZnF_C2H2	439	461	1.01e-1	SMART
low complexity region	463	475	N/A	INTRINSIC
ZnF_C2H2	495	517	6.47e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000199322

Coding Region Coverage

1x: 98.7%
3x: 97.5%
10x: 95.7%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein. The zinc finger proteins are involved in DNA binding and protein-protein interactions. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	C	1: 71,264,881	Y2079C	probably damaging	Het
Alg2	T	C	4: 47,472,101	R236G	probably damaging	Het
Alpl	T	A	4: 137,746,422	N323I	probably damaging	Het
Anxa3	A	G	5: 96,828,379	E172G	probably benign	Het
Atp8a2	A	G	14: 59,793,865		probably null	Het
Cadps	T	C	14: 12,454,285	K1078E	probably damaging	Het
Ces2e	G	T	8: 104,929,911	V258L	probably benign	Het
Daam2	A	G	17: 49,459,057	F1041S	probably benign	Het
Dcstamp	A	G	15: 39,754,536	I114V	probably benign	Het
Ddhd2	C	T	8: 25,739,560	R496Q	probably benign	Het
Dnhd1	G	A	7: 105,703,209	R2523Q	probably damaging	Het
Eml6	T	A	11: 29,764,126	R1335S	probably benign	Het
F12	T	C	13: 55,422,059	N102S	probably benign	Het
Fbn1	G	A	2: 125,373,950	L712F	probably benign	Het
Fgf1	G	T	18: 38,858,604	F37L	probably damaging	Het
Fgf14	T	A	14: 123,980,455	H212L	probably damaging	Het
Gm10036	A	T	18: 15,832,801	Q3L	probably benign	Het
Hivep1	T	C	13: 42,156,650	F789L	possibly damaging	Het
Hspg2	C	A	4: 137,551,828	T3074N	probably damaging	Het
Katnb1	C	T	8: 95,097,672	R495C	probably damaging	Het
Kdm5b	C	T	1: 134,588,003	H122Y	probably damaging	Het
Ky	C	T	9: 102,542,075	S427L	probably benign	Het
Med9	T	G	11: 59,960,660	V105G	probably benign	Het
Ndufa11	T	A	17: 56,721,059	V43D	probably damaging	Het
Nlrp4b	T	A	7: 10,714,946	C359S	possibly damaging	Het
Olfr361	T	A	2: 37,084,909	I280F	possibly damaging	Het
Olfr558	A	T	7: 102,709,693	K145*	probably null	Het
Paxbp1	T	A	16: 91,030,513	Y478F	possibly damaging	Het
Pole	G	A	5: 110,332,466	E92K	probably benign	Het
Prom1	G	T	5: 44,026,768	L449M	probably damaging	Het
Psg28	G	A	7: 18,430,448	T113I	probably benign	Het
Reln	A	C	5: 21,932,715	V2493G	possibly damaging	Het
Rp1	C	T	1: 4,345,832	V1686I	probably benign	Het
Setbp1	T	C	18: 79,086,652	I122V	probably damaging	Het
Setd5	T	C	6: 113,121,568	Y721H	probably damaging	Het
Shroom1	T	C	11: 53,463,922	F223S	probably damaging	Het
Son	T	A	16: 91,655,466	L367Q	probably damaging	Het
Spred2	G	T	11: 20,021,301	D363Y	probably damaging	Het
Tbc1d8	T	G	1: 39,372,755	Y1000S	probably benign	Het
Tdp2	A	T	13: 24,838,236	K213*	probably null	Het
Tmem89	T	C	9: 108,915,477	I146T	probably damaging	Het
Vhl	T	C	6: 113,629,463	V147A	probably benign	Het
Vmn2r23	C	T	6: 123,713,451	L429F	probably benign	Het
Vrk2	T	C	11: 26,499,036	D186G	probably damaging	Het
Wisp2	T	C	2: 163,825,359		probably null	Het
Zbtb40	A	G	4: 136,983,163	F1222L	possibly damaging	Het
Zfp266	A	G	9: 20,506,734	S7P	probably damaging	Het
Zfp472	T	A	17: 32,978,433	I494K	possibly damaging	Het

Other mutations in Zfp655

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Zfp655	APN	5	145244145	missense	probably damaging	1.00
IGL01679:Zfp655	APN	5	145243827	missense	probably damaging	0.96
IGL02379:Zfp655	APN	5	145243955	missense	probably benign	0.13
IGL02647:Zfp655	APN	5	145243006	missense	probably benign
R0104:Zfp655	UTSW	5	145244015	missense	probably damaging	1.00
R0104:Zfp655	UTSW	5	145244015	missense	probably damaging	1.00
R0270:Zfp655	UTSW	5	145244457	missense	probably damaging	1.00
R0608:Zfp655	UTSW	5	145244057	missense	possibly damaging	0.57
R1528:Zfp655	UTSW	5	145244601	missense	probably damaging	0.98
R2076:Zfp655	UTSW	5	145244600	missense	possibly damaging	0.89
R2119:Zfp655	UTSW	5	145244784	missense	probably damaging	0.98
R2375:Zfp655	UTSW	5	145244396	missense	probably benign	0.10
R2403:Zfp655	UTSW	5	145244546	missense	probably benign	0.00
R4032:Zfp655	UTSW	5	145244048	missense	possibly damaging	0.50
R4532:Zfp655	UTSW	5	145244697	missense	probably benign	0.06
R4880:Zfp655	UTSW	5	145244358	missense	probably damaging	0.99
R5484:Zfp655	UTSW	5	145243635	missense	probably benign	0.01
R6193:Zfp655	UTSW	5	145244776	missense	probably benign	0.03
R6195:Zfp655	UTSW	5	145243762	missense	possibly damaging	0.52
R7050:Zfp655	UTSW	5	145244735	missense	probably benign	0.12
R7471:Zfp655	UTSW	5	145244732	missense	possibly damaging	0.80
R7612:Zfp655	UTSW	5	145237189	missense	unknown
R7626:Zfp655	UTSW	5	145237107	missense	probably damaging	1.00
R7989:Zfp655	UTSW	5	145244570	missense	probably damaging	1.00
R8557:Zfp655	UTSW	5	145244025	missense	probably benign	0.37
R8805:Zfp655	UTSW	5	145244480	missense	probably damaging	1.00
Z1176:Zfp655	UTSW	5	145244003	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGATGAATGTGGGCTGGCC -3'
(R):5'- GAACTTGACTAAATGTCTCCCCAAG -3'

Sequencing Primer
(F):5'- TGGGCTGGCCTATGTTAAACAAC -3'
(R):5'- CCAAGTTCACTGCATTCATAAGG -3'

Posted On

2016-10-06