Incidental Mutation 'R5529:Vmn2r23'
ID 433576
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Name vomeronasal 2, receptor 23
Synonyms EG435916
MMRRC Submission 043087-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R5529 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 123679780-123719198 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 123690410 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 429 (L429F)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
AlphaFold E9PXI5
Predicted Effect probably benign
Transcript: ENSMUST00000172391
AA Change: L429F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: L429F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 95.7%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,304,040 (GRCm39) Y2079C probably damaging Het
Alg2 T C 4: 47,472,101 (GRCm39) R236G probably damaging Het
Alpl T A 4: 137,473,733 (GRCm39) N323I probably damaging Het
Anxa3 A G 5: 96,976,238 (GRCm39) E172G probably benign Het
Atp8a2 A G 14: 60,031,314 (GRCm39) probably null Het
Cadps T C 14: 12,454,285 (GRCm38) K1078E probably damaging Het
Ccn5 T C 2: 163,667,279 (GRCm39) probably null Het
Ces2e G T 8: 105,656,543 (GRCm39) V258L probably benign Het
Daam2 A G 17: 49,766,085 (GRCm39) F1041S probably benign Het
Dcstamp A G 15: 39,617,932 (GRCm39) I114V probably benign Het
Ddhd2 C T 8: 26,229,587 (GRCm39) R496Q probably benign Het
Dnhd1 G A 7: 105,352,416 (GRCm39) R2523Q probably damaging Het
Eml6 T A 11: 29,714,126 (GRCm39) R1335S probably benign Het
F12 T C 13: 55,569,872 (GRCm39) N102S probably benign Het
Fbn1 G A 2: 125,215,870 (GRCm39) L712F probably benign Het
Fgf1 G T 18: 38,991,657 (GRCm39) F37L probably damaging Het
Fgf14 T A 14: 124,217,867 (GRCm39) H212L probably damaging Het
Gm10036 A T 18: 15,965,858 (GRCm39) Q3L probably benign Het
Hivep1 T C 13: 42,310,126 (GRCm39) F789L possibly damaging Het
Hspg2 C A 4: 137,279,139 (GRCm39) T3074N probably damaging Het
Katnb1 C T 8: 95,824,300 (GRCm39) R495C probably damaging Het
Kdm5b C T 1: 134,515,741 (GRCm39) H122Y probably damaging Het
Ky C T 9: 102,419,274 (GRCm39) S427L probably benign Het
Med9 T G 11: 59,851,486 (GRCm39) V105G probably benign Het
Ndufa11 T A 17: 57,028,059 (GRCm39) V43D probably damaging Het
Nlrp4b T A 7: 10,448,873 (GRCm39) C359S possibly damaging Het
Or12k8 T A 2: 36,974,921 (GRCm39) I280F possibly damaging Het
Or51e1 A T 7: 102,358,900 (GRCm39) K145* probably null Het
Paxbp1 T A 16: 90,827,401 (GRCm39) Y478F possibly damaging Het
Pole G A 5: 110,480,332 (GRCm39) E92K probably benign Het
Prom1 G T 5: 44,184,110 (GRCm39) L449M probably damaging Het
Psg28 G A 7: 18,164,373 (GRCm39) T113I probably benign Het
Reln A C 5: 22,137,713 (GRCm39) V2493G possibly damaging Het
Rp1 C T 1: 4,416,055 (GRCm39) V1686I probably benign Het
Setbp1 T C 18: 79,129,867 (GRCm39) I122V probably damaging Het
Setd5 T C 6: 113,098,529 (GRCm39) Y721H probably damaging Het
Shroom1 T C 11: 53,354,749 (GRCm39) F223S probably damaging Het
Son T A 16: 91,452,354 (GRCm39) L367Q probably damaging Het
Spred2 G T 11: 19,971,301 (GRCm39) D363Y probably damaging Het
Tbc1d8 T G 1: 39,411,836 (GRCm39) Y1000S probably benign Het
Tdp2 A T 13: 25,022,219 (GRCm39) K213* probably null Het
Tmem89 T C 9: 108,744,545 (GRCm39) I146T probably damaging Het
Vhl T C 6: 113,606,424 (GRCm39) V147A probably benign Het
Vrk2 T C 11: 26,449,036 (GRCm39) D186G probably damaging Het
Zbtb40 A G 4: 136,710,474 (GRCm39) F1222L possibly damaging Het
Zfp266 A G 9: 20,418,030 (GRCm39) S7P probably damaging Het
Zfp472 T A 17: 33,197,407 (GRCm39) I494K possibly damaging Het
Zfp655 A G 5: 145,181,546 (GRCm39) E468G probably damaging Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123,706,684 (GRCm39) missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123,706,555 (GRCm39) missense probably benign
IGL01073:Vmn2r23 APN 6 123,689,759 (GRCm39) missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123,681,383 (GRCm39) missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123,681,366 (GRCm39) missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123,718,845 (GRCm39) missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123,718,819 (GRCm39) missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123,718,703 (GRCm39) missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123,718,795 (GRCm39) missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123,681,437 (GRCm39) missense probably benign
IGL02831:Vmn2r23 APN 6 123,681,344 (GRCm39) missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123,681,355 (GRCm39) missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123,718,578 (GRCm39) missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123,718,741 (GRCm39) missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123,681,333 (GRCm39) missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123,706,585 (GRCm39) missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123,706,680 (GRCm39) missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123,719,094 (GRCm39) missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123,718,963 (GRCm39) missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123,690,229 (GRCm39) nonsense probably null
R1629:Vmn2r23 UTSW 6 123,690,386 (GRCm39) missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123,706,649 (GRCm39) missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123,679,874 (GRCm39) missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123,689,969 (GRCm39) missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123,718,458 (GRCm39) missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123,681,384 (GRCm39) missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123,719,147 (GRCm39) nonsense probably null
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123,690,129 (GRCm39) missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123,718,348 (GRCm39) missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123,706,697 (GRCm39) missense probably benign
R4506:Vmn2r23 UTSW 6 123,679,884 (GRCm39) missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123,718,689 (GRCm39) missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123,718,785 (GRCm39) missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123,710,308 (GRCm39) missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123,689,961 (GRCm39) missense probably damaging 1.00
R5664:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R5761:Vmn2r23 UTSW 6 123,689,718 (GRCm39) missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123,689,901 (GRCm39) missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123,718,854 (GRCm39) missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123,681,359 (GRCm39) missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123,689,861 (GRCm39) missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123,690,384 (GRCm39) missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R6925:Vmn2r23 UTSW 6 123,681,512 (GRCm39) missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123,689,981 (GRCm39) missense probably benign
R7215:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123,718,540 (GRCm39) missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123,681,538 (GRCm39) missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123,681,500 (GRCm39) missense probably benign 0.00
R8143:Vmn2r23 UTSW 6 123,718,312 (GRCm39) missense probably damaging 0.99
R8474:Vmn2r23 UTSW 6 123,681,599 (GRCm39) missense probably benign 0.36
R8520:Vmn2r23 UTSW 6 123,718,615 (GRCm39) missense probably damaging 0.99
R8679:Vmn2r23 UTSW 6 123,690,431 (GRCm39) missense probably damaging 0.99
R8713:Vmn2r23 UTSW 6 123,679,991 (GRCm39) missense
R8966:Vmn2r23 UTSW 6 123,719,079 (GRCm39) missense possibly damaging 0.94
R9124:Vmn2r23 UTSW 6 123,719,038 (GRCm39) missense possibly damaging 0.57
R9163:Vmn2r23 UTSW 6 123,718,782 (GRCm39) missense probably damaging 1.00
R9189:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R9451:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R9495:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
R9514:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
RF018:Vmn2r23 UTSW 6 123,690,075 (GRCm39) missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123,690,120 (GRCm39) missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123,719,067 (GRCm39) missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123,706,684 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATCTTTATCCAGGATGTGTGGTCC -3'
(R):5'- CTTTGAGGAAGGAGACAGTACTC -3'

Sequencing Primer
(F):5'- GTCCATATTTTGAACAGCATGGG -3'
(R):5'- GGAGACAGTACTCTAAAGAACTATGC -3'
Posted On 2016-10-06