Mutagenetix > Incidental Mutations

Incidental Mutation 'R5529:Olfr558'

433579

Institutional Source

Beutler Lab

Gene Symbol

Olfr558

Ensembl Gene

ENSMUSG00000070423

Gene Name

olfactory receptor 558

Synonyms

MOR18-1, GA_x6K02T2PBJ9-5425951-5426904

MMRRC Submission

043087-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.061) question?

Stock #

R5529 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

102702215-102712064 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 102709693 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 145 (K145*)

Ref Sequence

ENSEMBL: ENSMUSP00000091674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084817] [ENSMUST00000094124] [ENSMUST00000216312]

AlphaFold

Q8VGZ7

Predicted Effect

probably benign
Transcript: ENSMUST00000084817

SMART Domains

Protein: ENSMUSP00000081877
Gene: ENSMUSG00000066273

Domain	Start	End	E-Value	Type
Pfam:7tm_4	37	317	2.1e-117	PFAM
Pfam:7TM_GPCR_Srsx	41	211	7.5e-11	PFAM
Pfam:7tm_1	47	299	2.4e-19	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000094124
AA Change: K145*

SMART Domains

Protein: ENSMUSP00000091674
Gene: ENSMUSG00000070423
AA Change: K145*

Domain	Start	End	E-Value	Type
Pfam:7tm_4	33	311	6.2e-117	PFAM
Pfam:7TM_GPCR_Srsx	37	308	2.4e-7	PFAM
Pfam:7tm_1	43	293	2.4e-19	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210002

Predicted Effect

probably benign
Transcript: ENSMUST00000216312

Coding Region Coverage

1x: 98.7%
3x: 97.5%
10x: 95.7%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	C	1: 71,264,881	Y2079C	probably damaging	Het
Alg2	T	C	4: 47,472,101	R236G	probably damaging	Het
Alpl	T	A	4: 137,746,422	N323I	probably damaging	Het
Anxa3	A	G	5: 96,828,379	E172G	probably benign	Het
Atp8a2	A	G	14: 59,793,865		probably null	Het
Cadps	T	C	14: 12,454,285	K1078E	probably damaging	Het
Ces2e	G	T	8: 104,929,911	V258L	probably benign	Het
Daam2	A	G	17: 49,459,057	F1041S	probably benign	Het
Dcstamp	A	G	15: 39,754,536	I114V	probably benign	Het
Ddhd2	C	T	8: 25,739,560	R496Q	probably benign	Het
Dnhd1	G	A	7: 105,703,209	R2523Q	probably damaging	Het
Eml6	T	A	11: 29,764,126	R1335S	probably benign	Het
F12	T	C	13: 55,422,059	N102S	probably benign	Het
Fbn1	G	A	2: 125,373,950	L712F	probably benign	Het
Fgf1	G	T	18: 38,858,604	F37L	probably damaging	Het
Fgf14	T	A	14: 123,980,455	H212L	probably damaging	Het
Gm10036	A	T	18: 15,832,801	Q3L	probably benign	Het
Hivep1	T	C	13: 42,156,650	F789L	possibly damaging	Het
Hspg2	C	A	4: 137,551,828	T3074N	probably damaging	Het
Katnb1	C	T	8: 95,097,672	R495C	probably damaging	Het
Kdm5b	C	T	1: 134,588,003	H122Y	probably damaging	Het
Ky	C	T	9: 102,542,075	S427L	probably benign	Het
Med9	T	G	11: 59,960,660	V105G	probably benign	Het
Ndufa11	T	A	17: 56,721,059	V43D	probably damaging	Het
Nlrp4b	T	A	7: 10,714,946	C359S	possibly damaging	Het
Olfr361	T	A	2: 37,084,909	I280F	possibly damaging	Het
Paxbp1	T	A	16: 91,030,513	Y478F	possibly damaging	Het
Pole	G	A	5: 110,332,466	E92K	probably benign	Het
Prom1	G	T	5: 44,026,768	L449M	probably damaging	Het
Psg28	G	A	7: 18,430,448	T113I	probably benign	Het
Reln	A	C	5: 21,932,715	V2493G	possibly damaging	Het
Rp1	C	T	1: 4,345,832	V1686I	probably benign	Het
Setbp1	T	C	18: 79,086,652	I122V	probably damaging	Het
Setd5	T	C	6: 113,121,568	Y721H	probably damaging	Het
Shroom1	T	C	11: 53,463,922	F223S	probably damaging	Het
Son	T	A	16: 91,655,466	L367Q	probably damaging	Het
Spred2	G	T	11: 20,021,301	D363Y	probably damaging	Het
Tbc1d8	T	G	1: 39,372,755	Y1000S	probably benign	Het
Tdp2	A	T	13: 24,838,236	K213*	probably null	Het
Tmem89	T	C	9: 108,915,477	I146T	probably damaging	Het
Vhl	T	C	6: 113,629,463	V147A	probably benign	Het
Vmn2r23	C	T	6: 123,713,451	L429F	probably benign	Het
Vrk2	T	C	11: 26,499,036	D186G	probably damaging	Het
Wisp2	T	C	2: 163,825,359		probably null	Het
Zbtb40	A	G	4: 136,983,163	F1222L	possibly damaging	Het
Zfp266	A	G	9: 20,506,734	S7P	probably damaging	Het
Zfp472	T	A	17: 32,978,433	I494K	possibly damaging	Het
Zfp655	A	G	5: 145,244,736	E468G	probably damaging	Het

Other mutations in Olfr558

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01670:Olfr558	APN	7	102709565	missense	probably damaging	0.99
IGL01925:Olfr558	APN	7	102710203	missense	probably damaging	0.98
IGL02172:Olfr558	APN	7	102709844	missense	probably benign
R0197:Olfr558	UTSW	7	102709995	missense	probably damaging	1.00
R0883:Olfr558	UTSW	7	102709995	missense	probably damaging	1.00
R1870:Olfr558	UTSW	7	102709754	missense	possibly damaging	0.92
R2894:Olfr558	UTSW	7	102709675	missense	probably damaging	0.99
R4033:Olfr558	UTSW	7	102709490	missense	probably damaging	1.00
R4695:Olfr558	UTSW	7	102709557	missense	probably damaging	1.00
R4738:Olfr558	UTSW	7	102710171	missense	probably damaging	1.00
R4739:Olfr558	UTSW	7	102710171	missense	probably damaging	1.00
R4740:Olfr558	UTSW	7	102710171	missense	probably damaging	1.00
R4901:Olfr558	UTSW	7	102710198	missense	probably benign	0.00
R5187:Olfr558	UTSW	7	102709661	missense	probably damaging	1.00
R5385:Olfr558	UTSW	7	102709346	missense	probably damaging	1.00
R6666:Olfr558	UTSW	7	102709928	splice site	probably null
R7318:Olfr558	UTSW	7	102710019	nonsense	probably null
R7453:Olfr558	UTSW	7	102709517	missense	probably damaging	0.99
R7546:Olfr558	UTSW	7	102709789	missense	probably damaging	1.00
R7643:Olfr558	UTSW	7	102709538	missense	probably benign	0.00
R8387:Olfr558	UTSW	7	102710195	missense	probably benign
R8984:Olfr558	UTSW	7	102710012	missense	possibly damaging	0.60
R9154:Olfr558	UTSW	7	102709334	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCTTTCTGGCCTAGACATC -3'
(R):5'- GTCCAAACCAATGGCTGAGATG -3'

Sequencing Primer
(F):5'- TCATCCATGCCAAAAATGATGG -3'
(R):5'- CCAAACCAATGGCTGAGATGATGAC -3'

Posted On

2016-10-06