Incidental Mutation 'R5529:Katnb1'
ID433583
Institutional Source Beutler Lab
Gene Symbol Katnb1
Ensembl Gene ENSMUSG00000031787
Gene Namekatanin p80 (WD40-containing) subunit B 1
Synonyms2410003J24Rik, KAT
MMRRC Submission 043087-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5529 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location95081186-95103149 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 95097672 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 495 (R495C)
Ref Sequence ENSEMBL: ENSMUSP00000034239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034239] [ENSMUST00000034240] [ENSMUST00000169353] [ENSMUST00000169748] [ENSMUST00000212968] [ENSMUST00000213004]
Predicted Effect probably damaging
Transcript: ENSMUST00000034239
AA Change: R495C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034239
Gene: ENSMUSG00000031787
AA Change: R495C

DomainStartEndE-ValueType
WD40 9 49 2.61e-3 SMART
WD40 52 91 2.45e-8 SMART
WD40 94 133 3.58e-10 SMART
WD40 136 175 7.49e-13 SMART
WD40 178 217 5.14e-11 SMART
WD40 220 258 1.14e-3 SMART
low complexity region 354 373 N/A INTRINSIC
low complexity region 396 412 N/A INTRINSIC
Pfam:Katanin_con80 496 654 8.2e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034240
SMART Domains Protein: ENSMUSP00000034240
Gene: ENSMUSG00000031788

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
coiled coil region 100 360 N/A INTRINSIC
coiled coil region 393 430 N/A INTRINSIC
KISc 441 774 3.15e-158 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169353
SMART Domains Protein: ENSMUSP00000127427
Gene: ENSMUSG00000031788

DomainStartEndE-ValueType
coiled coil region 33 223 N/A INTRINSIC
coiled coil region 256 293 N/A INTRINSIC
KISc 304 637 3.15e-158 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169748
SMART Domains Protein: ENSMUSP00000126784
Gene: ENSMUSG00000031788

DomainStartEndE-ValueType
coiled coil region 34 324 N/A INTRINSIC
coiled coil region 357 394 N/A INTRINSIC
KISc 405 728 3.11e-148 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212895
Predicted Effect probably benign
Transcript: ENSMUST00000212968
Predicted Effect probably benign
Transcript: ENSMUST00000213004
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 95.7%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Microtubules, polymers of alpha and beta tubulin subunits, form the mitotic spindle of a dividing cell and help to organize membranous organelles during interphase. Katanin is a heterodimer that consists of a 60 kDa ATPase (p60 subunit A 1) and an 80 kDa accessory protein (p80 subunit B 1). The p60 subunit acts to sever and disassemble microtubules, while the p80 subunit targets the enzyme to the centrosome. Katanin is a member of the AAA family of ATPases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit embryonic lethality, small embryo, brain and limb bud size, variable eye defects, holoprosencephaly, and thin cerebral cortex with fewer cortical progenitors and post-mitotic neurons. Mutant MEFs form multiple centrioles, multipolar spindles, and supernumerary primary cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,264,881 Y2079C probably damaging Het
Alg2 T C 4: 47,472,101 R236G probably damaging Het
Alpl T A 4: 137,746,422 N323I probably damaging Het
Anxa3 A G 5: 96,828,379 E172G probably benign Het
Atp8a2 A G 14: 59,793,865 probably null Het
Cadps T C 14: 12,454,285 K1078E probably damaging Het
Ces2e G T 8: 104,929,911 V258L probably benign Het
Daam2 A G 17: 49,459,057 F1041S probably benign Het
Dcstamp A G 15: 39,754,536 I114V probably benign Het
Ddhd2 C T 8: 25,739,560 R496Q probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Eml6 T A 11: 29,764,126 R1335S probably benign Het
F12 T C 13: 55,422,059 N102S probably benign Het
Fbn1 G A 2: 125,373,950 L712F probably benign Het
Fgf1 G T 18: 38,858,604 F37L probably damaging Het
Fgf14 T A 14: 123,980,455 H212L probably damaging Het
Gm10036 A T 18: 15,832,801 Q3L probably benign Het
Hivep1 T C 13: 42,156,650 F789L possibly damaging Het
Hspg2 C A 4: 137,551,828 T3074N probably damaging Het
Kdm5b C T 1: 134,588,003 H122Y probably damaging Het
Ky C T 9: 102,542,075 S427L probably benign Het
Med9 T G 11: 59,960,660 V105G probably benign Het
Ndufa11 T A 17: 56,721,059 V43D probably damaging Het
Nlrp4b T A 7: 10,714,946 C359S possibly damaging Het
Olfr361 T A 2: 37,084,909 I280F possibly damaging Het
Olfr558 A T 7: 102,709,693 K145* probably null Het
Paxbp1 T A 16: 91,030,513 Y478F possibly damaging Het
Pole G A 5: 110,332,466 E92K probably benign Het
Prom1 G T 5: 44,026,768 L449M probably damaging Het
Psg28 G A 7: 18,430,448 T113I probably benign Het
Reln A C 5: 21,932,715 V2493G possibly damaging Het
Rp1 C T 1: 4,345,832 V1686I probably benign Het
Setbp1 T C 18: 79,086,652 I122V probably damaging Het
Setd5 T C 6: 113,121,568 Y721H probably damaging Het
Shroom1 T C 11: 53,463,922 F223S probably damaging Het
Son T A 16: 91,655,466 L367Q probably damaging Het
Spred2 G T 11: 20,021,301 D363Y probably damaging Het
Tbc1d8 T G 1: 39,372,755 Y1000S probably benign Het
Tdp2 A T 13: 24,838,236 K213* probably null Het
Tmem89 T C 9: 108,915,477 I146T probably damaging Het
Vhl T C 6: 113,629,463 V147A probably benign Het
Vmn2r23 C T 6: 123,713,451 L429F probably benign Het
Vrk2 T C 11: 26,499,036 D186G probably damaging Het
Wisp2 T C 2: 163,825,359 probably null Het
Zbtb40 A G 4: 136,983,163 F1222L possibly damaging Het
Zfp266 A G 9: 20,506,734 S7P probably damaging Het
Zfp472 T A 17: 32,978,433 I494K possibly damaging Het
Zfp655 A G 5: 145,244,736 E468G probably damaging Het
Other mutations in Katnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Katnb1 APN 8 95098159 missense probably damaging 1.00
IGL02263:Katnb1 APN 8 95090075 missense probably damaging 1.00
IGL02896:Katnb1 APN 8 95096028 unclassified probably benign
H8562:Katnb1 UTSW 8 95095510 unclassified probably benign
R0139:Katnb1 UTSW 8 95098422 missense possibly damaging 0.90
R0418:Katnb1 UTSW 8 95095658 missense possibly damaging 0.92
R0503:Katnb1 UTSW 8 95095174 missense probably damaging 0.96
R1405:Katnb1 UTSW 8 95098173 missense probably damaging 1.00
R1405:Katnb1 UTSW 8 95098173 missense probably damaging 1.00
R3960:Katnb1 UTSW 8 95087297 missense possibly damaging 0.48
R4866:Katnb1 UTSW 8 95097504 missense possibly damaging 0.78
R4930:Katnb1 UTSW 8 95097294 splice site probably null
R5160:Katnb1 UTSW 8 95095470 missense probably benign 0.01
R5184:Katnb1 UTSW 8 95097980 missense possibly damaging 0.80
R5333:Katnb1 UTSW 8 95095606 missense possibly damaging 0.95
R5848:Katnb1 UTSW 8 95098712 missense probably benign 0.09
R6424:Katnb1 UTSW 8 95093516 missense probably damaging 1.00
R6478:Katnb1 UTSW 8 95095456 missense possibly damaging 0.57
R6785:Katnb1 UTSW 8 95095642 missense probably benign 0.04
R7009:Katnb1 UTSW 8 95098384 missense probably damaging 0.99
R7174:Katnb1 UTSW 8 95097441 missense probably benign 0.00
R7253:Katnb1 UTSW 8 95095497 nonsense probably null
R7486:Katnb1 UTSW 8 95098729 missense probably damaging 1.00
R7718:Katnb1 UTSW 8 95095208 missense possibly damaging 0.78
R7996:Katnb1 UTSW 8 95098015 missense possibly damaging 0.95
R8108:Katnb1 UTSW 8 95093945 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGAACCTGACATCATCCCTGC -3'
(R):5'- CAGTGCTCAGCTGATGGAAG -3'

Sequencing Primer
(F):5'- CACACGGAATGAGCCCATTGG -3'
(R):5'- GCTGGCTGCTCTAACACAAG -3'
Posted On2016-10-06