Mutagenetix > Incidental Mutations

Incidental Mutation 'R5529:Katnb1'

433583

Institutional Source

Beutler Lab

Gene Symbol

Katnb1

Ensembl Gene

ENSMUSG00000031787

Gene Name

katanin p80 (WD40-containing) subunit B 1

Synonyms

2410003J24Rik, KAT

MMRRC Submission

043087-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5529 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

95081186-95103149 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 95097672 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 495 (R495C)

Ref Sequence

ENSEMBL: ENSMUSP00000034239 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034239] [ENSMUST00000034240] [ENSMUST00000169353] [ENSMUST00000169748] [ENSMUST00000212968] [ENSMUST00000213004]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034239
AA Change: R495C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000034239
Gene: ENSMUSG00000031787
AA Change: R495C

Domain	Start	End	E-Value	Type
WD40	9	49	2.61e-3	SMART
WD40	52	91	2.45e-8	SMART
WD40	94	133	3.58e-10	SMART
WD40	136	175	7.49e-13	SMART
WD40	178	217	5.14e-11	SMART
WD40	220	258	1.14e-3	SMART
low complexity region	354	373	N/A	INTRINSIC
low complexity region	396	412	N/A	INTRINSIC
Pfam:Katanin_con80	496	654	8.2e-59	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000034240

SMART Domains

Protein: ENSMUSP00000034240
Gene: ENSMUSG00000031788

Domain	Start	End	E-Value	Type
low complexity region	33	46	N/A	INTRINSIC
coiled coil region	100	360	N/A	INTRINSIC
coiled coil region	393	430	N/A	INTRINSIC
KISc	441	774	3.15e-158	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000169353

SMART Domains

Protein: ENSMUSP00000127427
Gene: ENSMUSG00000031788

Domain	Start	End	E-Value	Type
coiled coil region	33	223	N/A	INTRINSIC
coiled coil region	256	293	N/A	INTRINSIC
KISc	304	637	3.15e-158	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000169748

SMART Domains

Protein: ENSMUSP00000126784
Gene: ENSMUSG00000031788

Domain	Start	End	E-Value	Type
coiled coil region	34	324	N/A	INTRINSIC
coiled coil region	357	394	N/A	INTRINSIC
KISc	405	728	3.11e-148	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212528

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212565

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212656

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212895

Predicted Effect

probably benign
Transcript: ENSMUST00000212968

Predicted Effect

probably benign
Transcript: ENSMUST00000213004

Coding Region Coverage

1x: 98.7%
3x: 97.5%
10x: 95.7%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Microtubules, polymers of alpha and beta tubulin subunits, form the mitotic spindle of a dividing cell and help to organize membranous organelles during interphase. Katanin is a heterodimer that consists of a 60 kDa ATPase (p60 subunit A 1) and an 80 kDa accessory protein (p80 subunit B 1). The p60 subunit acts to sever and disassemble microtubules, while the p80 subunit targets the enzyme to the centrosome. Katanin is a member of the AAA family of ATPases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit embryonic lethality, small embryo, brain and limb bud size, variable eye defects, holoprosencephaly, and thin cerebral cortex with fewer cortical progenitors and post-mitotic neurons. Mutant MEFs form multiple centrioles, multipolar spindles, and supernumerary primary cilia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	C	1: 71,264,881	Y2079C	probably damaging	Het
Alg2	T	C	4: 47,472,101	R236G	probably damaging	Het
Alpl	T	A	4: 137,746,422	N323I	probably damaging	Het
Anxa3	A	G	5: 96,828,379	E172G	probably benign	Het
Atp8a2	A	G	14: 59,793,865		probably null	Het
Cadps	T	C	14: 12,454,285	K1078E	probably damaging	Het
Ces2e	G	T	8: 104,929,911	V258L	probably benign	Het
Daam2	A	G	17: 49,459,057	F1041S	probably benign	Het
Dcstamp	A	G	15: 39,754,536	I114V	probably benign	Het
Ddhd2	C	T	8: 25,739,560	R496Q	probably benign	Het
Dnhd1	G	A	7: 105,703,209	R2523Q	probably damaging	Het
Eml6	T	A	11: 29,764,126	R1335S	probably benign	Het
F12	T	C	13: 55,422,059	N102S	probably benign	Het
Fbn1	G	A	2: 125,373,950	L712F	probably benign	Het
Fgf1	G	T	18: 38,858,604	F37L	probably damaging	Het
Fgf14	T	A	14: 123,980,455	H212L	probably damaging	Het
Gm10036	A	T	18: 15,832,801	Q3L	probably benign	Het
Hivep1	T	C	13: 42,156,650	F789L	possibly damaging	Het
Hspg2	C	A	4: 137,551,828	T3074N	probably damaging	Het
Kdm5b	C	T	1: 134,588,003	H122Y	probably damaging	Het
Ky	C	T	9: 102,542,075	S427L	probably benign	Het
Med9	T	G	11: 59,960,660	V105G	probably benign	Het
Ndufa11	T	A	17: 56,721,059	V43D	probably damaging	Het
Nlrp4b	T	A	7: 10,714,946	C359S	possibly damaging	Het
Olfr361	T	A	2: 37,084,909	I280F	possibly damaging	Het
Olfr558	A	T	7: 102,709,693	K145*	probably null	Het
Paxbp1	T	A	16: 91,030,513	Y478F	possibly damaging	Het
Pole	G	A	5: 110,332,466	E92K	probably benign	Het
Prom1	G	T	5: 44,026,768	L449M	probably damaging	Het
Psg28	G	A	7: 18,430,448	T113I	probably benign	Het
Reln	A	C	5: 21,932,715	V2493G	possibly damaging	Het
Rp1	C	T	1: 4,345,832	V1686I	probably benign	Het
Setbp1	T	C	18: 79,086,652	I122V	probably damaging	Het
Setd5	T	C	6: 113,121,568	Y721H	probably damaging	Het
Shroom1	T	C	11: 53,463,922	F223S	probably damaging	Het
Son	T	A	16: 91,655,466	L367Q	probably damaging	Het
Spred2	G	T	11: 20,021,301	D363Y	probably damaging	Het
Tbc1d8	T	G	1: 39,372,755	Y1000S	probably benign	Het
Tdp2	A	T	13: 24,838,236	K213*	probably null	Het
Tmem89	T	C	9: 108,915,477	I146T	probably damaging	Het
Vhl	T	C	6: 113,629,463	V147A	probably benign	Het
Vmn2r23	C	T	6: 123,713,451	L429F	probably benign	Het
Vrk2	T	C	11: 26,499,036	D186G	probably damaging	Het
Wisp2	T	C	2: 163,825,359		probably null	Het
Zbtb40	A	G	4: 136,983,163	F1222L	possibly damaging	Het
Zfp266	A	G	9: 20,506,734	S7P	probably damaging	Het
Zfp472	T	A	17: 32,978,433	I494K	possibly damaging	Het
Zfp655	A	G	5: 145,244,736	E468G	probably damaging	Het

Other mutations in Katnb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01563:Katnb1	APN	8	95098159	missense	probably damaging	1.00
IGL02263:Katnb1	APN	8	95090075	missense	probably damaging	1.00
IGL02896:Katnb1	APN	8	95096028	unclassified	probably benign
H8562:Katnb1	UTSW	8	95095510	unclassified	probably benign
R0139:Katnb1	UTSW	8	95098422	missense	possibly damaging	0.90
R0418:Katnb1	UTSW	8	95095658	missense	possibly damaging	0.92
R0503:Katnb1	UTSW	8	95095174	missense	probably damaging	0.96
R1405:Katnb1	UTSW	8	95098173	missense	probably damaging	1.00
R1405:Katnb1	UTSW	8	95098173	missense	probably damaging	1.00
R3960:Katnb1	UTSW	8	95087297	missense	possibly damaging	0.48
R4866:Katnb1	UTSW	8	95097504	missense	possibly damaging	0.78
R4930:Katnb1	UTSW	8	95097294	splice site	probably null
R5160:Katnb1	UTSW	8	95095470	missense	probably benign	0.01
R5184:Katnb1	UTSW	8	95097980	missense	possibly damaging	0.80
R5333:Katnb1	UTSW	8	95095606	missense	possibly damaging	0.95
R5848:Katnb1	UTSW	8	95098712	missense	probably benign	0.09
R6424:Katnb1	UTSW	8	95093516	missense	probably damaging	1.00
R6478:Katnb1	UTSW	8	95095456	missense	possibly damaging	0.57
R6785:Katnb1	UTSW	8	95095642	missense	probably benign	0.04
R7009:Katnb1	UTSW	8	95098384	missense	probably damaging	0.99
R7174:Katnb1	UTSW	8	95097441	missense	probably benign	0.00
R7253:Katnb1	UTSW	8	95095497	nonsense	probably null
R7486:Katnb1	UTSW	8	95098729	missense	probably damaging	1.00
R7718:Katnb1	UTSW	8	95095208	missense	possibly damaging	0.78
R7996:Katnb1	UTSW	8	95098015	missense	possibly damaging	0.95
R8108:Katnb1	UTSW	8	95093945	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TGAACCTGACATCATCCCTGC -3'
(R):5'- CAGTGCTCAGCTGATGGAAG -3'

Sequencing Primer
(F):5'- CACACGGAATGAGCCCATTGG -3'
(R):5'- GCTGGCTGCTCTAACACAAG -3'

Posted On

2016-10-06