Incidental Mutation 'R5529:Tmem89'
ID433587
Institutional Source Beutler Lab
Gene Symbol Tmem89
Ensembl Gene ENSMUSG00000025652
Gene Nametransmembrane protein 89
Synonyms1700024B07Rik
MMRRC Submission 043087-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R5529 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108914619-108915563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108915477 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 146 (I146T)
Ref Sequence ENSEMBL: ENSMUSP00000026744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026744] [ENSMUST00000098376] [ENSMUST00000192852]
Predicted Effect probably damaging
Transcript: ENSMUST00000026744
AA Change: I146T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026744
Gene: ENSMUSG00000025652
AA Change: I146T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TMEM89 23 47 6.3e-16 PFAM
Pfam:TMEM89 46 166 1.1e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098376
SMART Domains Protein: ENSMUSP00000095979
Gene: ENSMUSG00000023259

DomainStartEndE-ValueType
Pfam:Sulfate_transp 69 458 4.4e-113 PFAM
low complexity region 471 484 N/A INTRINSIC
PDB:3LLO|A 489 546 2e-16 PDB
low complexity region 554 593 N/A INTRINSIC
low complexity region 638 650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191404
Predicted Effect probably benign
Transcript: ENSMUST00000192852
SMART Domains Protein: ENSMUSP00000142016
Gene: ENSMUSG00000025652

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TMEM89 23 47 1.8e-15 PFAM
Pfam:TMEM89 45 118 1.3e-37 PFAM
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 95.7%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,264,881 Y2079C probably damaging Het
Alg2 T C 4: 47,472,101 R236G probably damaging Het
Alpl T A 4: 137,746,422 N323I probably damaging Het
Anxa3 A G 5: 96,828,379 E172G probably benign Het
Atp8a2 A G 14: 59,793,865 probably null Het
Cadps T C 14: 12,454,285 K1078E probably damaging Het
Ces2e G T 8: 104,929,911 V258L probably benign Het
Daam2 A G 17: 49,459,057 F1041S probably benign Het
Dcstamp A G 15: 39,754,536 I114V probably benign Het
Ddhd2 C T 8: 25,739,560 R496Q probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Eml6 T A 11: 29,764,126 R1335S probably benign Het
F12 T C 13: 55,422,059 N102S probably benign Het
Fbn1 G A 2: 125,373,950 L712F probably benign Het
Fgf1 G T 18: 38,858,604 F37L probably damaging Het
Fgf14 T A 14: 123,980,455 H212L probably damaging Het
Gm10036 A T 18: 15,832,801 Q3L probably benign Het
Hivep1 T C 13: 42,156,650 F789L possibly damaging Het
Hspg2 C A 4: 137,551,828 T3074N probably damaging Het
Katnb1 C T 8: 95,097,672 R495C probably damaging Het
Kdm5b C T 1: 134,588,003 H122Y probably damaging Het
Ky C T 9: 102,542,075 S427L probably benign Het
Med9 T G 11: 59,960,660 V105G probably benign Het
Ndufa11 T A 17: 56,721,059 V43D probably damaging Het
Nlrp4b T A 7: 10,714,946 C359S possibly damaging Het
Olfr361 T A 2: 37,084,909 I280F possibly damaging Het
Olfr558 A T 7: 102,709,693 K145* probably null Het
Paxbp1 T A 16: 91,030,513 Y478F possibly damaging Het
Pole G A 5: 110,332,466 E92K probably benign Het
Prom1 G T 5: 44,026,768 L449M probably damaging Het
Psg28 G A 7: 18,430,448 T113I probably benign Het
Reln A C 5: 21,932,715 V2493G possibly damaging Het
Rp1 C T 1: 4,345,832 V1686I probably benign Het
Setbp1 T C 18: 79,086,652 I122V probably damaging Het
Setd5 T C 6: 113,121,568 Y721H probably damaging Het
Shroom1 T C 11: 53,463,922 F223S probably damaging Het
Son T A 16: 91,655,466 L367Q probably damaging Het
Spred2 G T 11: 20,021,301 D363Y probably damaging Het
Tbc1d8 T G 1: 39,372,755 Y1000S probably benign Het
Tdp2 A T 13: 24,838,236 K213* probably null Het
Vhl T C 6: 113,629,463 V147A probably benign Het
Vmn2r23 C T 6: 123,713,451 L429F probably benign Het
Vrk2 T C 11: 26,499,036 D186G probably damaging Het
Wisp2 T C 2: 163,825,359 probably null Het
Zbtb40 A G 4: 136,983,163 F1222L possibly damaging Het
Zfp266 A G 9: 20,506,734 S7P probably damaging Het
Zfp472 T A 17: 32,978,433 I494K possibly damaging Het
Zfp655 A G 5: 145,244,736 E468G probably damaging Het
Other mutations in Tmem89
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0060:Tmem89 UTSW 9 108915417 missense probably damaging 1.00
R0060:Tmem89 UTSW 9 108915417 missense probably damaging 1.00
R0063:Tmem89 UTSW 9 108914812 missense probably benign 0.00
R0063:Tmem89 UTSW 9 108914812 missense probably benign 0.00
R2447:Tmem89 UTSW 9 108914800 missense probably damaging 0.98
R4778:Tmem89 UTSW 9 108915375 missense probably damaging 0.98
R4906:Tmem89 UTSW 9 108914761 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGACCCAGTGACCTATTCCC -3'
(R):5'- CACTGATCTCTTTTGTGGGACC -3'

Sequencing Primer
(F):5'- AGTGACCTATTCCCCTGTCC -3'
(R):5'- GAACGTCAGAGCTGATCT -3'
Posted On2016-10-06