Mutagenetix > Incidental Mutations

Incidental Mutation 'R5529:Cadps'

433596

Institutional Source

Beutler Lab

Gene Symbol

Cadps

Ensembl Gene

ENSMUSG00000054423

Gene Name

Ca2+-dependent secretion activator

Synonyms

CAPS1

MMRRC Submission

043087-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5529 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12372563-12823079 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 12454285 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 1078 (K1078E)

Ref Sequence

ENSEMBL: ENSMUSP00000064706 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067491] [ENSMUST00000112657] [ENSMUST00000112658] [ENSMUST00000177814] [ENSMUST00000224882]

Predicted Effect

probably damaging
Transcript: ENSMUST00000067491
AA Change: K1078E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000064706
Gene: ENSMUSG00000054423
AA Change: K1078E

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	41	75	N/A	INTRINSIC
coiled coil region	93	121	N/A	INTRINSIC
C2	397	492	1.08e-2	SMART
PH	520	624	1.78e-10	SMART
low complexity region	772	783	N/A	INTRINSIC
DUF1041	833	948	6.21e-54	SMART
low complexity region	1022	1045	N/A	INTRINSIC
low complexity region	1354	1361	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112657
AA Change: K1071E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000108276
Gene: ENSMUSG00000054423
AA Change: K1071E

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	41	75	N/A	INTRINSIC
coiled coil region	93	121	N/A	INTRINSIC
C2	397	492	1.08e-2	SMART
PH	520	624	1.78e-10	SMART
low complexity region	775	786	N/A	INTRINSIC
DUF1041	836	941	3.88e-55	SMART
low complexity region	1015	1038	N/A	INTRINSIC
low complexity region	1347	1354	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112658
AA Change: K1072E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000108277
Gene: ENSMUSG00000054423
AA Change: K1072E

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	41	75	N/A	INTRINSIC
coiled coil region	93	121	N/A	INTRINSIC
C2	397	492	1.08e-2	SMART
PH	520	624	1.78e-10	SMART
low complexity region	776	787	N/A	INTRINSIC
DUF1041	837	942	3.88e-55	SMART
low complexity region	1016	1039	N/A	INTRINSIC
low complexity region	1348	1355	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000177814
AA Change: K1073E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000136076
Gene: ENSMUSG00000054423
AA Change: K1073E

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	41	75	N/A	INTRINSIC
coiled coil region	93	121	N/A	INTRINSIC
C2	397	492	1.08e-2	SMART
PH	520	624	1.78e-10	SMART
low complexity region	777	788	N/A	INTRINSIC
DUF1041	838	943	2.75e-55	SMART
low complexity region	1017	1040	N/A	INTRINSIC
low complexity region	1349	1356	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224106

Predicted Effect

unknown
Transcript: ENSMUST00000224581
AA Change: K202E

Predicted Effect

probably benign
Transcript: ENSMUST00000224882

Coding Region Coverage

1x: 98.7%
3x: 97.5%
10x: 95.7%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel neural/endocrine-specific cytosolic and peripheral membrane protein required for the Ca2+-regulated exocytosis of secretory vesicles. The protein acts at a stage in exocytosis that follows ATP-dependent priming, which involves the essential synthesis of phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2). Alternative splicing has been observed at this locus and three variants, encoding distinct isoforms, are described. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality, respiratory failure and abnormal adrenal gland physiology. Adult heterozygous null mice display abnormal adrenal gland physiology that is different from that seen in homozygous neonates. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	C	1: 71,264,881	Y2079C	probably damaging	Het
Alg2	T	C	4: 47,472,101	R236G	probably damaging	Het
Alpl	T	A	4: 137,746,422	N323I	probably damaging	Het
Anxa3	A	G	5: 96,828,379	E172G	probably benign	Het
Atp8a2	A	G	14: 59,793,865		probably null	Het
Ces2e	G	T	8: 104,929,911	V258L	probably benign	Het
Daam2	A	G	17: 49,459,057	F1041S	probably benign	Het
Dcstamp	A	G	15: 39,754,536	I114V	probably benign	Het
Ddhd2	C	T	8: 25,739,560	R496Q	probably benign	Het
Dnhd1	G	A	7: 105,703,209	R2523Q	probably damaging	Het
Eml6	T	A	11: 29,764,126	R1335S	probably benign	Het
F12	T	C	13: 55,422,059	N102S	probably benign	Het
Fbn1	G	A	2: 125,373,950	L712F	probably benign	Het
Fgf1	G	T	18: 38,858,604	F37L	probably damaging	Het
Fgf14	T	A	14: 123,980,455	H212L	probably damaging	Het
Gm10036	A	T	18: 15,832,801	Q3L	probably benign	Het
Hivep1	T	C	13: 42,156,650	F789L	possibly damaging	Het
Hspg2	C	A	4: 137,551,828	T3074N	probably damaging	Het
Katnb1	C	T	8: 95,097,672	R495C	probably damaging	Het
Kdm5b	C	T	1: 134,588,003	H122Y	probably damaging	Het
Ky	C	T	9: 102,542,075	S427L	probably benign	Het
Med9	T	G	11: 59,960,660	V105G	probably benign	Het
Ndufa11	T	A	17: 56,721,059	V43D	probably damaging	Het
Nlrp4b	T	A	7: 10,714,946	C359S	possibly damaging	Het
Olfr361	T	A	2: 37,084,909	I280F	possibly damaging	Het
Olfr558	A	T	7: 102,709,693	K145*	probably null	Het
Paxbp1	T	A	16: 91,030,513	Y478F	possibly damaging	Het
Pole	G	A	5: 110,332,466	E92K	probably benign	Het
Prom1	G	T	5: 44,026,768	L449M	probably damaging	Het
Psg28	G	A	7: 18,430,448	T113I	probably benign	Het
Reln	A	C	5: 21,932,715	V2493G	possibly damaging	Het
Rp1	C	T	1: 4,345,832	V1686I	probably benign	Het
Setbp1	T	C	18: 79,086,652	I122V	probably damaging	Het
Setd5	T	C	6: 113,121,568	Y721H	probably damaging	Het
Shroom1	T	C	11: 53,463,922	F223S	probably damaging	Het
Son	T	A	16: 91,655,466	L367Q	probably damaging	Het
Spred2	G	T	11: 20,021,301	D363Y	probably damaging	Het
Tbc1d8	T	G	1: 39,372,755	Y1000S	probably benign	Het
Tdp2	A	T	13: 24,838,236	K213*	probably null	Het
Tmem89	T	C	9: 108,915,477	I146T	probably damaging	Het
Vhl	T	C	6: 113,629,463	V147A	probably benign	Het
Vmn2r23	C	T	6: 123,713,451	L429F	probably benign	Het
Vrk2	T	C	11: 26,499,036	D186G	probably damaging	Het
Wisp2	T	C	2: 163,825,359		probably null	Het
Zbtb40	A	G	4: 136,983,163	F1222L	possibly damaging	Het
Zfp266	A	G	9: 20,506,734	S7P	probably damaging	Het
Zfp472	T	A	17: 32,978,433	I494K	possibly damaging	Het
Zfp655	A	G	5: 145,244,736	E468G	probably damaging	Het

Other mutations in Cadps

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00926:Cadps	APN	14	12491795	missense	probably damaging	1.00
IGL00990:Cadps	APN	14	12715374	missense	possibly damaging	0.56
IGL01071:Cadps	APN	14	12509091	splice site	probably null
IGL01339:Cadps	APN	14	12486543	missense	possibly damaging	0.58
IGL01518:Cadps	APN	14	12522352	missense	probably damaging	1.00
IGL01560:Cadps	APN	14	12491792	missense	probably damaging	1.00
IGL01598:Cadps	APN	14	12522202	critical splice donor site	probably null
IGL01603:Cadps	APN	14	12454154	splice site	probably benign
IGL01836:Cadps	APN	14	12522311	missense	probably damaging	1.00
IGL01839:Cadps	APN	14	12467184	splice site	probably benign
IGL01932:Cadps	APN	14	12373609	utr 3 prime	probably benign
IGL02172:Cadps	APN	14	12705681	missense	probably damaging	1.00
IGL02175:Cadps	APN	14	12467092	missense	probably damaging	0.96
IGL02212:Cadps	APN	14	12522345	missense	possibly damaging	0.94
IGL02351:Cadps	APN	14	12597380	missense	probably damaging	0.99
IGL02358:Cadps	APN	14	12597380	missense	probably damaging	0.99
IGL02499:Cadps	APN	14	12822725	nonsense	probably null
IGL02505:Cadps	APN	14	12449759	missense	probably damaging	1.00
IGL02591:Cadps	APN	14	12473465	missense	probably damaging	1.00
IGL02592:Cadps	APN	14	12473465	missense	probably damaging	1.00
IGL02671:Cadps	APN	14	12491824	missense	probably damaging	1.00
IGL02956:Cadps	APN	14	12418047	splice site	probably benign
IGL03029:Cadps	APN	14	12376675	missense	probably damaging	1.00
IGL03216:Cadps	APN	14	12439944	missense	probably damaging	1.00
IGL03282:Cadps	APN	14	12465856	splice site	probably benign
turbo	UTSW	14	12491800	missense	probably damaging	1.00
R0241:Cadps	UTSW	14	12376675	missense	probably damaging	1.00
R0241:Cadps	UTSW	14	12376675	missense	probably damaging	1.00
R0420:Cadps	UTSW	14	12491800	missense	probably damaging	1.00
R1180:Cadps	UTSW	14	12457836	splice site	probably benign
R1398:Cadps	UTSW	14	12449822	missense	probably damaging	1.00
R1678:Cadps	UTSW	14	12517802	critical splice donor site	probably null
R1792:Cadps	UTSW	14	12449802	missense	possibly damaging	0.93
R1863:Cadps	UTSW	14	12449802	missense	possibly damaging	0.93
R1863:Cadps	UTSW	14	12505796	missense	probably benign	0.09
R1918:Cadps	UTSW	14	12546372	missense	probably damaging	0.99
R1920:Cadps	UTSW	14	12465859	missense	possibly damaging	0.64
R1921:Cadps	UTSW	14	12465859	missense	possibly damaging	0.64
R1922:Cadps	UTSW	14	12465859	missense	possibly damaging	0.64
R1925:Cadps	UTSW	14	12705726	missense	probably damaging	1.00
R1966:Cadps	UTSW	14	12822450	nonsense	probably null
R2013:Cadps	UTSW	14	12522337	missense	probably damaging	1.00
R2228:Cadps	UTSW	14	12465935	missense	probably benign	0.05
R2331:Cadps	UTSW	14	12603692	missense	probably damaging	1.00
R3436:Cadps	UTSW	14	12616158	splice site	probably null
R3853:Cadps	UTSW	14	12509090	splice site	probably benign
R3893:Cadps	UTSW	14	12488883	utr 3 prime	probably benign
R3916:Cadps	UTSW	14	12457702	missense	probably benign	0.00
R3917:Cadps	UTSW	14	12457702	missense	probably benign	0.00
R3953:Cadps	UTSW	14	12505937	missense	probably damaging	1.00
R3966:Cadps	UTSW	14	12522161	splice site	probably null
R4024:Cadps	UTSW	14	12705539	missense	probably damaging	1.00
R4079:Cadps	UTSW	14	12457702	missense	probably benign	0.00
R4230:Cadps	UTSW	14	12488987	missense	probably damaging	0.98
R4333:Cadps	UTSW	14	12467031	missense	probably damaging	1.00
R4410:Cadps	UTSW	14	12822323	missense	probably damaging	0.98
R4586:Cadps	UTSW	14	12505808	missense	probably damaging	1.00
R4685:Cadps	UTSW	14	12467139	missense	possibly damaging	0.77
R4698:Cadps	UTSW	14	12705654	missense	possibly damaging	0.90
R4855:Cadps	UTSW	14	12822449	missense	unknown
R4898:Cadps	UTSW	14	12411588	missense	possibly damaging	0.86
R4908:Cadps	UTSW	14	12536386	missense	probably damaging	1.00
R5208:Cadps	UTSW	14	12457711	missense	possibly damaging	0.68
R5297:Cadps	UTSW	14	12822345	missense	probably damaging	1.00
R5328:Cadps	UTSW	14	12457790	missense	probably benign	0.31
R5408:Cadps	UTSW	14	12705759	missense	possibly damaging	0.87
R5567:Cadps	UTSW	14	12473497	missense	possibly damaging	0.49
R5570:Cadps	UTSW	14	12473497	missense	possibly damaging	0.49
R5727:Cadps	UTSW	14	12486525	nonsense	probably null
R5812:Cadps	UTSW	14	12376685	missense	probably benign
R6361:Cadps	UTSW	14	12491778	nonsense	probably null
R6767:Cadps	UTSW	14	12550888	missense	probably damaging	1.00
R6805:Cadps	UTSW	14	12467103	missense	probably damaging	0.99
R6861:Cadps	UTSW	14	12522401	nonsense	probably null
R6883:Cadps	UTSW	14	12465883	missense	probably damaging	0.96
R6887:Cadps	UTSW	14	12505811	missense	probably damaging	1.00
R6997:Cadps	UTSW	14	12505793	missense	possibly damaging	0.88
R7102:Cadps	UTSW	14	12603738	missense	probably damaging	1.00
R7120:Cadps	UTSW	14	12439919	missense	probably damaging	0.98
R7143:Cadps	UTSW	14	12491838	missense	probably benign	0.02
R7290:Cadps	UTSW	14	12616099	missense	probably damaging	1.00
R7614:Cadps	UTSW	14	12454260	missense	probably damaging	1.00
R7674:Cadps	UTSW	14	12411581	missense	probably damaging	0.99
R7715:Cadps	UTSW	14	12457762	missense	probably benign	0.01
R7801:Cadps	UTSW	14	12489476	critical splice donor site	probably null
R7814:Cadps	UTSW	14	12376706	missense	probably damaging	0.99
R8087:Cadps	UTSW	14	12536380	missense	probably damaging	1.00
X0018:Cadps	UTSW	14	12373690	missense	probably damaging	1.00
X0028:Cadps	UTSW	14	12467118	missense	possibly damaging	0.93
Z1088:Cadps	UTSW	14	12467113	missense	probably damaging	0.96
Z1177:Cadps	UTSW	14	12465880	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTGTCATGGGCTCACTGGTC -3'
(R):5'- TTCTGCCAGTGGAGATTGC -3'

Sequencing Primer
(F):5'- GTCTTTCCAGGGCTGCACAATG -3'
(R):5'- CCCCCTTCTGCCACCAAC -3'

Posted On

2016-10-06