Incidental Mutation 'R5529:Cadps'
ID433596
Institutional Source Beutler Lab
Gene Symbol Cadps
Ensembl Gene ENSMUSG00000054423
Gene NameCa2+-dependent secretion activator
SynonymsCAPS1
MMRRC Submission 043087-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5529 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location12372563-12823079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12454285 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1078 (K1078E)
Ref Sequence ENSEMBL: ENSMUSP00000064706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067491] [ENSMUST00000112657] [ENSMUST00000112658] [ENSMUST00000177814] [ENSMUST00000224882]
Predicted Effect probably damaging
Transcript: ENSMUST00000067491
AA Change: K1078E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064706
Gene: ENSMUSG00000054423
AA Change: K1078E

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 772 783 N/A INTRINSIC
DUF1041 833 948 6.21e-54 SMART
low complexity region 1022 1045 N/A INTRINSIC
low complexity region 1354 1361 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112657
AA Change: K1071E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108276
Gene: ENSMUSG00000054423
AA Change: K1071E

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 775 786 N/A INTRINSIC
DUF1041 836 941 3.88e-55 SMART
low complexity region 1015 1038 N/A INTRINSIC
low complexity region 1347 1354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112658
AA Change: K1072E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108277
Gene: ENSMUSG00000054423
AA Change: K1072E

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 776 787 N/A INTRINSIC
DUF1041 837 942 3.88e-55 SMART
low complexity region 1016 1039 N/A INTRINSIC
low complexity region 1348 1355 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177814
AA Change: K1073E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136076
Gene: ENSMUSG00000054423
AA Change: K1073E

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 777 788 N/A INTRINSIC
DUF1041 838 943 2.75e-55 SMART
low complexity region 1017 1040 N/A INTRINSIC
low complexity region 1349 1356 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224106
Predicted Effect unknown
Transcript: ENSMUST00000224581
AA Change: K202E
Predicted Effect probably benign
Transcript: ENSMUST00000224882
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 95.7%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel neural/endocrine-specific cytosolic and peripheral membrane protein required for the Ca2+-regulated exocytosis of secretory vesicles. The protein acts at a stage in exocytosis that follows ATP-dependent priming, which involves the essential synthesis of phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2). Alternative splicing has been observed at this locus and three variants, encoding distinct isoforms, are described. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality, respiratory failure and abnormal adrenal gland physiology. Adult heterozygous null mice display abnormal adrenal gland physiology that is different from that seen in homozygous neonates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,264,881 Y2079C probably damaging Het
Alg2 T C 4: 47,472,101 R236G probably damaging Het
Alpl T A 4: 137,746,422 N323I probably damaging Het
Anxa3 A G 5: 96,828,379 E172G probably benign Het
Atp8a2 A G 14: 59,793,865 probably null Het
Ces2e G T 8: 104,929,911 V258L probably benign Het
Daam2 A G 17: 49,459,057 F1041S probably benign Het
Dcstamp A G 15: 39,754,536 I114V probably benign Het
Ddhd2 C T 8: 25,739,560 R496Q probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Eml6 T A 11: 29,764,126 R1335S probably benign Het
F12 T C 13: 55,422,059 N102S probably benign Het
Fbn1 G A 2: 125,373,950 L712F probably benign Het
Fgf1 G T 18: 38,858,604 F37L probably damaging Het
Fgf14 T A 14: 123,980,455 H212L probably damaging Het
Gm10036 A T 18: 15,832,801 Q3L probably benign Het
Hivep1 T C 13: 42,156,650 F789L possibly damaging Het
Hspg2 C A 4: 137,551,828 T3074N probably damaging Het
Katnb1 C T 8: 95,097,672 R495C probably damaging Het
Kdm5b C T 1: 134,588,003 H122Y probably damaging Het
Ky C T 9: 102,542,075 S427L probably benign Het
Med9 T G 11: 59,960,660 V105G probably benign Het
Ndufa11 T A 17: 56,721,059 V43D probably damaging Het
Nlrp4b T A 7: 10,714,946 C359S possibly damaging Het
Olfr361 T A 2: 37,084,909 I280F possibly damaging Het
Olfr558 A T 7: 102,709,693 K145* probably null Het
Paxbp1 T A 16: 91,030,513 Y478F possibly damaging Het
Pole G A 5: 110,332,466 E92K probably benign Het
Prom1 G T 5: 44,026,768 L449M probably damaging Het
Psg28 G A 7: 18,430,448 T113I probably benign Het
Reln A C 5: 21,932,715 V2493G possibly damaging Het
Rp1 C T 1: 4,345,832 V1686I probably benign Het
Setbp1 T C 18: 79,086,652 I122V probably damaging Het
Setd5 T C 6: 113,121,568 Y721H probably damaging Het
Shroom1 T C 11: 53,463,922 F223S probably damaging Het
Son T A 16: 91,655,466 L367Q probably damaging Het
Spred2 G T 11: 20,021,301 D363Y probably damaging Het
Tbc1d8 T G 1: 39,372,755 Y1000S probably benign Het
Tdp2 A T 13: 24,838,236 K213* probably null Het
Tmem89 T C 9: 108,915,477 I146T probably damaging Het
Vhl T C 6: 113,629,463 V147A probably benign Het
Vmn2r23 C T 6: 123,713,451 L429F probably benign Het
Vrk2 T C 11: 26,499,036 D186G probably damaging Het
Wisp2 T C 2: 163,825,359 probably null Het
Zbtb40 A G 4: 136,983,163 F1222L possibly damaging Het
Zfp266 A G 9: 20,506,734 S7P probably damaging Het
Zfp472 T A 17: 32,978,433 I494K possibly damaging Het
Zfp655 A G 5: 145,244,736 E468G probably damaging Het
Other mutations in Cadps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Cadps APN 14 12491795 missense probably damaging 1.00
IGL00990:Cadps APN 14 12715374 missense possibly damaging 0.56
IGL01071:Cadps APN 14 12509091 splice site probably null
IGL01339:Cadps APN 14 12486543 missense possibly damaging 0.58
IGL01518:Cadps APN 14 12522352 missense probably damaging 1.00
IGL01560:Cadps APN 14 12491792 missense probably damaging 1.00
IGL01598:Cadps APN 14 12522202 critical splice donor site probably null
IGL01603:Cadps APN 14 12454154 splice site probably benign
IGL01836:Cadps APN 14 12522311 missense probably damaging 1.00
IGL01839:Cadps APN 14 12467184 splice site probably benign
IGL01932:Cadps APN 14 12373609 utr 3 prime probably benign
IGL02172:Cadps APN 14 12705681 missense probably damaging 1.00
IGL02175:Cadps APN 14 12467092 missense probably damaging 0.96
IGL02212:Cadps APN 14 12522345 missense possibly damaging 0.94
IGL02351:Cadps APN 14 12597380 missense probably damaging 0.99
IGL02358:Cadps APN 14 12597380 missense probably damaging 0.99
IGL02499:Cadps APN 14 12822725 nonsense probably null
IGL02505:Cadps APN 14 12449759 missense probably damaging 1.00
IGL02591:Cadps APN 14 12473465 missense probably damaging 1.00
IGL02592:Cadps APN 14 12473465 missense probably damaging 1.00
IGL02671:Cadps APN 14 12491824 missense probably damaging 1.00
IGL02956:Cadps APN 14 12418047 splice site probably benign
IGL03029:Cadps APN 14 12376675 missense probably damaging 1.00
IGL03216:Cadps APN 14 12439944 missense probably damaging 1.00
IGL03282:Cadps APN 14 12465856 splice site probably benign
turbo UTSW 14 12491800 missense probably damaging 1.00
R0241:Cadps UTSW 14 12376675 missense probably damaging 1.00
R0241:Cadps UTSW 14 12376675 missense probably damaging 1.00
R0420:Cadps UTSW 14 12491800 missense probably damaging 1.00
R1180:Cadps UTSW 14 12457836 splice site probably benign
R1398:Cadps UTSW 14 12449822 missense probably damaging 1.00
R1678:Cadps UTSW 14 12517802 critical splice donor site probably null
R1792:Cadps UTSW 14 12449802 missense possibly damaging 0.93
R1863:Cadps UTSW 14 12449802 missense possibly damaging 0.93
R1863:Cadps UTSW 14 12505796 missense probably benign 0.09
R1918:Cadps UTSW 14 12546372 missense probably damaging 0.99
R1920:Cadps UTSW 14 12465859 missense possibly damaging 0.64
R1921:Cadps UTSW 14 12465859 missense possibly damaging 0.64
R1922:Cadps UTSW 14 12465859 missense possibly damaging 0.64
R1925:Cadps UTSW 14 12705726 missense probably damaging 1.00
R1966:Cadps UTSW 14 12822450 nonsense probably null
R2013:Cadps UTSW 14 12522337 missense probably damaging 1.00
R2228:Cadps UTSW 14 12465935 missense probably benign 0.05
R2331:Cadps UTSW 14 12603692 missense probably damaging 1.00
R3436:Cadps UTSW 14 12616158 splice site probably null
R3853:Cadps UTSW 14 12509090 splice site probably benign
R3893:Cadps UTSW 14 12488883 utr 3 prime probably benign
R3916:Cadps UTSW 14 12457702 missense probably benign 0.00
R3917:Cadps UTSW 14 12457702 missense probably benign 0.00
R3953:Cadps UTSW 14 12505937 missense probably damaging 1.00
R3966:Cadps UTSW 14 12522161 splice site probably null
R4024:Cadps UTSW 14 12705539 missense probably damaging 1.00
R4079:Cadps UTSW 14 12457702 missense probably benign 0.00
R4230:Cadps UTSW 14 12488987 missense probably damaging 0.98
R4333:Cadps UTSW 14 12467031 missense probably damaging 1.00
R4410:Cadps UTSW 14 12822323 missense probably damaging 0.98
R4586:Cadps UTSW 14 12505808 missense probably damaging 1.00
R4685:Cadps UTSW 14 12467139 missense possibly damaging 0.77
R4698:Cadps UTSW 14 12705654 missense possibly damaging 0.90
R4855:Cadps UTSW 14 12822449 missense unknown
R4898:Cadps UTSW 14 12411588 missense possibly damaging 0.86
R4908:Cadps UTSW 14 12536386 missense probably damaging 1.00
R5208:Cadps UTSW 14 12457711 missense possibly damaging 0.68
R5297:Cadps UTSW 14 12822345 missense probably damaging 1.00
R5328:Cadps UTSW 14 12457790 missense probably benign 0.31
R5408:Cadps UTSW 14 12705759 missense possibly damaging 0.87
R5567:Cadps UTSW 14 12473497 missense possibly damaging 0.49
R5570:Cadps UTSW 14 12473497 missense possibly damaging 0.49
R5727:Cadps UTSW 14 12486525 nonsense probably null
R5812:Cadps UTSW 14 12376685 missense probably benign
R6361:Cadps UTSW 14 12491778 nonsense probably null
R6767:Cadps UTSW 14 12550888 missense probably damaging 1.00
R6805:Cadps UTSW 14 12467103 missense probably damaging 0.99
R6861:Cadps UTSW 14 12522401 nonsense probably null
R6883:Cadps UTSW 14 12465883 missense probably damaging 0.96
R6887:Cadps UTSW 14 12505811 missense probably damaging 1.00
R6997:Cadps UTSW 14 12505793 missense possibly damaging 0.88
R7102:Cadps UTSW 14 12603738 missense probably damaging 1.00
R7120:Cadps UTSW 14 12439919 missense probably damaging 0.98
R7143:Cadps UTSW 14 12491838 missense probably benign 0.02
R7290:Cadps UTSW 14 12616099 missense probably damaging 1.00
R7614:Cadps UTSW 14 12454260 missense probably damaging 1.00
R7674:Cadps UTSW 14 12411581 missense probably damaging 0.99
R7715:Cadps UTSW 14 12457762 missense probably benign 0.01
R7801:Cadps UTSW 14 12489476 critical splice donor site probably null
R7814:Cadps UTSW 14 12376706 missense probably damaging 0.99
R8087:Cadps UTSW 14 12536380 missense probably damaging 1.00
X0018:Cadps UTSW 14 12373690 missense probably damaging 1.00
X0028:Cadps UTSW 14 12467118 missense possibly damaging 0.93
Z1088:Cadps UTSW 14 12467113 missense probably damaging 0.96
Z1177:Cadps UTSW 14 12465880 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGTCATGGGCTCACTGGTC -3'
(R):5'- TTCTGCCAGTGGAGATTGC -3'

Sequencing Primer
(F):5'- GTCTTTCCAGGGCTGCACAATG -3'
(R):5'- CCCCCTTCTGCCACCAAC -3'
Posted On2016-10-06