Incidental Mutation 'R5529:Fgf14'
ID433598
Institutional Source Beutler Lab
Gene Symbol Fgf14
Ensembl Gene ENSMUSG00000025551
Gene Namefibroblast growth factor 14
SynonymsFhf4
MMRRC Submission 043087-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R5529 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location123977907-124677127 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123980455 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 212 (H212L)
Ref Sequence ENSEMBL: ENSMUSP00000026631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026631] [ENSMUST00000049681] [ENSMUST00000095529] [ENSMUST00000132026]
Predicted Effect probably damaging
Transcript: ENSMUST00000026631
AA Change: H212L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026631
Gene: ENSMUSG00000025551
AA Change: H212L

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
FGF 69 200 1.75e-63 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000049681
SMART Domains Protein: ENSMUSP00000059019
Gene: ENSMUSG00000032925

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
internal_repeat_1 62 164 7.9e-12 PROSPERO
EGF_like 184 217 6.95e1 SMART
EGF 275 311 2.25e1 SMART
low complexity region 335 348 N/A INTRINSIC
Pfam:EGF_2 368 398 3.6e-8 PFAM
low complexity region 423 438 N/A INTRINSIC
low complexity region 448 456 N/A INTRINSIC
Blast:EGF_like 457 486 4e-9 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000095529
AA Change: H217L

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000093185
Gene: ENSMUSG00000025551
AA Change: H217L

DomainStartEndE-ValueType
FGF 74 205 1.75e-63 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117453
Predicted Effect probably benign
Transcript: ENSMUST00000132026
SMART Domains Protein: ENSMUSP00000115455
Gene: ENSMUSG00000032925

DomainStartEndE-ValueType
internal_repeat_2 22 50 3.54e-8 PROSPERO
internal_repeat_1 23 87 7.45e-14 PROSPERO
low complexity region 101 126 N/A INTRINSIC
EGF 151 187 2.25e1 SMART
low complexity region 211 224 N/A INTRINSIC
Pfam:EGF_2 239 274 1.5e-7 PFAM
low complexity region 299 314 N/A INTRINSIC
low complexity region 324 332 N/A INTRINSIC
internal_repeat_2 334 362 3.54e-8 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186300
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 95.7%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. A mutation in this gene is associated with autosomal dominant cerebral ataxia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display impaired balance and grip strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,264,881 Y2079C probably damaging Het
Alg2 T C 4: 47,472,101 R236G probably damaging Het
Alpl T A 4: 137,746,422 N323I probably damaging Het
Anxa3 A G 5: 96,828,379 E172G probably benign Het
Atp8a2 A G 14: 59,793,865 probably null Het
Cadps T C 14: 12,454,285 K1078E probably damaging Het
Ces2e G T 8: 104,929,911 V258L probably benign Het
Daam2 A G 17: 49,459,057 F1041S probably benign Het
Dcstamp A G 15: 39,754,536 I114V probably benign Het
Ddhd2 C T 8: 25,739,560 R496Q probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Eml6 T A 11: 29,764,126 R1335S probably benign Het
F12 T C 13: 55,422,059 N102S probably benign Het
Fbn1 G A 2: 125,373,950 L712F probably benign Het
Fgf1 G T 18: 38,858,604 F37L probably damaging Het
Gm10036 A T 18: 15,832,801 Q3L probably benign Het
Hivep1 T C 13: 42,156,650 F789L possibly damaging Het
Hspg2 C A 4: 137,551,828 T3074N probably damaging Het
Katnb1 C T 8: 95,097,672 R495C probably damaging Het
Kdm5b C T 1: 134,588,003 H122Y probably damaging Het
Ky C T 9: 102,542,075 S427L probably benign Het
Med9 T G 11: 59,960,660 V105G probably benign Het
Ndufa11 T A 17: 56,721,059 V43D probably damaging Het
Nlrp4b T A 7: 10,714,946 C359S possibly damaging Het
Olfr361 T A 2: 37,084,909 I280F possibly damaging Het
Olfr558 A T 7: 102,709,693 K145* probably null Het
Paxbp1 T A 16: 91,030,513 Y478F possibly damaging Het
Pole G A 5: 110,332,466 E92K probably benign Het
Prom1 G T 5: 44,026,768 L449M probably damaging Het
Psg28 G A 7: 18,430,448 T113I probably benign Het
Reln A C 5: 21,932,715 V2493G possibly damaging Het
Rp1 C T 1: 4,345,832 V1686I probably benign Het
Setbp1 T C 18: 79,086,652 I122V probably damaging Het
Setd5 T C 6: 113,121,568 Y721H probably damaging Het
Shroom1 T C 11: 53,463,922 F223S probably damaging Het
Son T A 16: 91,655,466 L367Q probably damaging Het
Spred2 G T 11: 20,021,301 D363Y probably damaging Het
Tbc1d8 T G 1: 39,372,755 Y1000S probably benign Het
Tdp2 A T 13: 24,838,236 K213* probably null Het
Tmem89 T C 9: 108,915,477 I146T probably damaging Het
Vhl T C 6: 113,629,463 V147A probably benign Het
Vmn2r23 C T 6: 123,713,451 L429F probably benign Het
Vrk2 T C 11: 26,499,036 D186G probably damaging Het
Wisp2 T C 2: 163,825,359 probably null Het
Zbtb40 A G 4: 136,983,163 F1222L possibly damaging Het
Zfp266 A G 9: 20,506,734 S7P probably damaging Het
Zfp472 T A 17: 32,978,433 I494K possibly damaging Het
Zfp655 A G 5: 145,244,736 E468G probably damaging Het
Other mutations in Fgf14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02136:Fgf14 APN 14 123980372 missense possibly damaging 0.51
IGL02733:Fgf14 APN 14 123983801 missense probably damaging 1.00
IGL02939:Fgf14 APN 14 124132479 missense possibly damaging 0.82
R0517:Fgf14 UTSW 14 123983784 missense probably damaging 1.00
R0608:Fgf14 UTSW 14 124676603 missense probably damaging 0.99
R1034:Fgf14 UTSW 14 124132534 missense probably damaging 0.96
R1183:Fgf14 UTSW 14 124676524 missense probably benign 0.03
R1466:Fgf14 UTSW 14 124676539 missense probably benign 0.19
R1466:Fgf14 UTSW 14 124676539 missense probably benign 0.19
R1584:Fgf14 UTSW 14 124676539 missense probably benign 0.19
R1768:Fgf14 UTSW 14 124676512 missense probably benign 0.00
R2190:Fgf14 UTSW 14 123983918 missense probably damaging 1.00
R2307:Fgf14 UTSW 14 123983822 missense probably damaging 1.00
R3743:Fgf14 UTSW 14 124676620 missense probably benign
R3847:Fgf14 UTSW 14 123980389 missense probably benign 0.05
R4859:Fgf14 UTSW 14 124192433 missense possibly damaging 0.78
R5655:Fgf14 UTSW 14 124192416 missense probably benign
R6242:Fgf14 UTSW 14 124676528 missense probably benign 0.02
R6958:Fgf14 UTSW 14 124676597 missense probably benign
R7460:Fgf14 UTSW 14 124676693 missense possibly damaging 0.92
R7726:Fgf14 UTSW 14 124136244 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAGACAGCATAAGACAAGC -3'
(R):5'- GCTGCTGTCCTGTTATCAATGG -3'

Sequencing Primer
(F):5'- TTTTCCGCCACAGGAGCAG -3'
(R):5'- CAATGGGATTGAGTTCATTCTCAG -3'
Posted On2016-10-06