Incidental Mutation 'R5529:Dcstamp'
ID433599
Institutional Source Beutler Lab
Gene Symbol Dcstamp
Ensembl Gene ENSMUSG00000022303
Gene Namedendrocyte expressed seven transmembrane protein
SynonymsTm7sf4, 4833414I07Rik, DC-STAMP
MMRRC Submission 043087-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.472) question?
Stock #R5529 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location39745930-39760938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39754536 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 114 (I114V)
Ref Sequence ENSEMBL: ENSMUSP00000154362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022913] [ENSMUST00000227368] [ENSMUST00000227792] [ENSMUST00000228556] [ENSMUST00000228701]
Predicted Effect probably benign
Transcript: ENSMUST00000022913
AA Change: I114V

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000022913
Gene: ENSMUSG00000022303
AA Change: I114V

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
transmembrane domain 58 75 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
Pfam:DC_STAMP 242 421 1e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227368
AA Change: I114V

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000227792
AA Change: I114V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000228556
AA Change: I114V

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000228701
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 95.7%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seven-pass transmembrane protein that is primarily expressed in dendritic cells. The encoded protein is involved in a range of immunological functions carried out by dendritic cells. This protein plays a role in osteoclastogenesis and myeloid differentiation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Targeted disruption of this gene causes complete loss of osteoclast and macrophage cell fusion and leads to reduced bone-resorbing activity and mild osteopetrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,264,881 Y2079C probably damaging Het
Alg2 T C 4: 47,472,101 R236G probably damaging Het
Alpl T A 4: 137,746,422 N323I probably damaging Het
Anxa3 A G 5: 96,828,379 E172G probably benign Het
Atp8a2 A G 14: 59,793,865 probably null Het
Cadps T C 14: 12,454,285 K1078E probably damaging Het
Ces2e G T 8: 104,929,911 V258L probably benign Het
Daam2 A G 17: 49,459,057 F1041S probably benign Het
Ddhd2 C T 8: 25,739,560 R496Q probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Eml6 T A 11: 29,764,126 R1335S probably benign Het
F12 T C 13: 55,422,059 N102S probably benign Het
Fbn1 G A 2: 125,373,950 L712F probably benign Het
Fgf1 G T 18: 38,858,604 F37L probably damaging Het
Fgf14 T A 14: 123,980,455 H212L probably damaging Het
Gm10036 A T 18: 15,832,801 Q3L probably benign Het
Hivep1 T C 13: 42,156,650 F789L possibly damaging Het
Hspg2 C A 4: 137,551,828 T3074N probably damaging Het
Katnb1 C T 8: 95,097,672 R495C probably damaging Het
Kdm5b C T 1: 134,588,003 H122Y probably damaging Het
Ky C T 9: 102,542,075 S427L probably benign Het
Med9 T G 11: 59,960,660 V105G probably benign Het
Ndufa11 T A 17: 56,721,059 V43D probably damaging Het
Nlrp4b T A 7: 10,714,946 C359S possibly damaging Het
Olfr361 T A 2: 37,084,909 I280F possibly damaging Het
Olfr558 A T 7: 102,709,693 K145* probably null Het
Paxbp1 T A 16: 91,030,513 Y478F possibly damaging Het
Pole G A 5: 110,332,466 E92K probably benign Het
Prom1 G T 5: 44,026,768 L449M probably damaging Het
Psg28 G A 7: 18,430,448 T113I probably benign Het
Reln A C 5: 21,932,715 V2493G possibly damaging Het
Rp1 C T 1: 4,345,832 V1686I probably benign Het
Setbp1 T C 18: 79,086,652 I122V probably damaging Het
Setd5 T C 6: 113,121,568 Y721H probably damaging Het
Shroom1 T C 11: 53,463,922 F223S probably damaging Het
Son T A 16: 91,655,466 L367Q probably damaging Het
Spred2 G T 11: 20,021,301 D363Y probably damaging Het
Tbc1d8 T G 1: 39,372,755 Y1000S probably benign Het
Tdp2 A T 13: 24,838,236 K213* probably null Het
Tmem89 T C 9: 108,915,477 I146T probably damaging Het
Vhl T C 6: 113,629,463 V147A probably benign Het
Vmn2r23 C T 6: 123,713,451 L429F probably benign Het
Vrk2 T C 11: 26,499,036 D186G probably damaging Het
Wisp2 T C 2: 163,825,359 probably null Het
Zbtb40 A G 4: 136,983,163 F1222L possibly damaging Het
Zfp266 A G 9: 20,506,734 S7P probably damaging Het
Zfp472 T A 17: 32,978,433 I494K possibly damaging Het
Zfp655 A G 5: 145,244,736 E468G probably damaging Het
Other mutations in Dcstamp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Dcstamp APN 15 39754416 missense probably benign 0.05
IGL01963:Dcstamp APN 15 39760359 missense possibly damaging 0.82
IGL02132:Dcstamp APN 15 39754532 missense probably damaging 0.97
IGL02139:Dcstamp APN 15 39754458 missense probably damaging 1.00
IGL02607:Dcstamp APN 15 39754584 missense possibly damaging 0.94
IGL03003:Dcstamp APN 15 39754510 missense possibly damaging 0.64
IGL03061:Dcstamp APN 15 39760397 missense possibly damaging 0.81
IGL03191:Dcstamp APN 15 39754224 missense probably benign 0.00
R1144:Dcstamp UTSW 15 39760368 missense possibly damaging 0.94
R1186:Dcstamp UTSW 15 39754629 unclassified probably null
R1663:Dcstamp UTSW 15 39754944 nonsense probably null
R2117:Dcstamp UTSW 15 39755175 nonsense probably null
R2202:Dcstamp UTSW 15 39754312 missense probably damaging 0.99
R4484:Dcstamp UTSW 15 39754224 missense probably benign 0.00
R4642:Dcstamp UTSW 15 39754722 missense probably benign 0.01
R5384:Dcstamp UTSW 15 39759319 missense probably damaging 0.99
R5558:Dcstamp UTSW 15 39759540 missense probably damaging 1.00
R5562:Dcstamp UTSW 15 39754402 missense possibly damaging 0.88
R6261:Dcstamp UTSW 15 39754735 missense possibly damaging 0.65
R6299:Dcstamp UTSW 15 39755203 missense probably damaging 1.00
R6377:Dcstamp UTSW 15 39754921 missense probably benign 0.01
R6566:Dcstamp UTSW 15 39754336 missense possibly damaging 0.54
R6596:Dcstamp UTSW 15 39754209 missense possibly damaging 0.95
R6869:Dcstamp UTSW 15 39754458 missense probably damaging 1.00
R7030:Dcstamp UTSW 15 39759533 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCAGCCTTTTACTGGATCC -3'
(R):5'- TCATTCATATGAGCCTCCAGGG -3'

Sequencing Primer
(F):5'- TACTGGATCCTGCCACCCG -3'
(R):5'- AGAGAGACCACCAGAGTCTG -3'
Posted On2016-10-06