Mutagenetix > Incidental Mutation

Incidental Mutation 'R5529:Son'

433601

Institutional Source

Beutler Lab

Gene Symbol

Son

Ensembl Gene

ENSMUSG00000022961

Gene Name

Son DNA binding protein

Synonyms

2900011L12Rik

MMRRC Submission

043087-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R5529 (G1)

Quality Score

133

Status

Not validated

Chromosome

Chromosomal Location

91647506-91679221 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 91655466 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 367 (L367Q)

Ref Sequence

ENSEMBL: ENSMUSP00000113129 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114036] [ENSMUST00000114037] [ENSMUST00000117633] [ENSMUST00000119368] [ENSMUST00000122302] [ENSMUST00000140312]

AlphaFold

Q9QX47

Predicted Effect

probably damaging
Transcript: ENSMUST00000114036
AA Change: L367Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000109670
Gene: ENSMUSG00000022961
AA Change: L367Q

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	1.65e-7	PROSPERO
internal_repeat_2	214	362	6.55e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	1.65e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	6.55e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000114037
AA Change: L367Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000109671
Gene: ENSMUSG00000022961
AA Change: L367Q

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	1.71e-7	PROSPERO
internal_repeat_2	214	362	7.05e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	1.71e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	7.05e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC
low complexity region	2149	2155	N/A	INTRINSIC
G_patch	2321	2367	1.15e-17	SMART
Pfam:DND1_DSRM	2388	2442	5.7e-15	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000117633
AA Change: L367Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112453
Gene: ENSMUSG00000022961
AA Change: L367Q

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	1.59e-7	PROSPERO
internal_repeat_2	214	362	6.63e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	1.59e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	6.63e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
Pfam:RSRP	1909	2216	1e-12	PFAM
G_patch	2321	2367	1.15e-17	SMART
DSRM	2390	2458	5.37e-20	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000119368
AA Change: L367Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113129
Gene: ENSMUSG00000022961
AA Change: L367Q

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	2.22e-7	PROSPERO
internal_repeat_2	214	362	8.67e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	2.22e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	8.67e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC
low complexity region	2149	2155	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000122302

SMART Domains

Protein: ENSMUSP00000113615
Gene: ENSMUSG00000022961

Domain	Start	End	E-Value	Type
low complexity region	90	101	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
low complexity region	159	165	N/A	INTRINSIC
G_patch	331	377	1.15e-17	SMART
Pfam:DND1_DSRM	398	452	7.9e-16	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000140312
AA Change: L367Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000122320
Gene: ENSMUSG00000022961
AA Change: L367Q

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	2.93e-7	PROSPERO
internal_repeat_2	214	362	1.1e-5	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	2.93e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	1.1e-5	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC
low complexity region	2149	2155	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000147891

SMART Domains

Protein: ENSMUSP00000122544
Gene: ENSMUSG00000022961

Domain	Start	End	E-Value	Type
Pfam:RSRP	61	358	2.9e-13	PFAM
low complexity region	466	477	N/A	INTRINSIC

Coding Region Coverage

1x: 98.7%
3x: 97.5%
10x: 95.7%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains multiple simple repeats. The encoded protein binds RNA and promotes pre-mRNA splicing, particularly of transcripts with poor splice sites. The protein also recognizes a specific DNA sequence found in the human hepatitis B virus (HBV) and represses HBV core promoter activity. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	C	1: 71,264,881	Y2079C	probably damaging	Het
Alg2	T	C	4: 47,472,101	R236G	probably damaging	Het
Alpl	T	A	4: 137,746,422	N323I	probably damaging	Het
Anxa3	A	G	5: 96,828,379	E172G	probably benign	Het
Atp8a2	A	G	14: 59,793,865		probably null	Het
Cadps	T	C	14: 12,454,285	K1078E	probably damaging	Het
Ces2e	G	T	8: 104,929,911	V258L	probably benign	Het
Daam2	A	G	17: 49,459,057	F1041S	probably benign	Het
Dcstamp	A	G	15: 39,754,536	I114V	probably benign	Het
Ddhd2	C	T	8: 25,739,560	R496Q	probably benign	Het
Dnhd1	G	A	7: 105,703,209	R2523Q	probably damaging	Het
Eml6	T	A	11: 29,764,126	R1335S	probably benign	Het
F12	T	C	13: 55,422,059	N102S	probably benign	Het
Fbn1	G	A	2: 125,373,950	L712F	probably benign	Het
Fgf1	G	T	18: 38,858,604	F37L	probably damaging	Het
Fgf14	T	A	14: 123,980,455	H212L	probably damaging	Het
Gm10036	A	T	18: 15,832,801	Q3L	probably benign	Het
Hivep1	T	C	13: 42,156,650	F789L	possibly damaging	Het
Hspg2	C	A	4: 137,551,828	T3074N	probably damaging	Het
Katnb1	C	T	8: 95,097,672	R495C	probably damaging	Het
Kdm5b	C	T	1: 134,588,003	H122Y	probably damaging	Het
Ky	C	T	9: 102,542,075	S427L	probably benign	Het
Med9	T	G	11: 59,960,660	V105G	probably benign	Het
Ndufa11	T	A	17: 56,721,059	V43D	probably damaging	Het
Nlrp4b	T	A	7: 10,714,946	C359S	possibly damaging	Het
Olfr361	T	A	2: 37,084,909	I280F	possibly damaging	Het
Olfr558	A	T	7: 102,709,693	K145*	probably null	Het
Paxbp1	T	A	16: 91,030,513	Y478F	possibly damaging	Het
Pole	G	A	5: 110,332,466	E92K	probably benign	Het
Prom1	G	T	5: 44,026,768	L449M	probably damaging	Het
Psg28	G	A	7: 18,430,448	T113I	probably benign	Het
Reln	A	C	5: 21,932,715	V2493G	possibly damaging	Het
Rp1	C	T	1: 4,345,832	V1686I	probably benign	Het
Setbp1	T	C	18: 79,086,652	I122V	probably damaging	Het
Setd5	T	C	6: 113,121,568	Y721H	probably damaging	Het
Shroom1	T	C	11: 53,463,922	F223S	probably damaging	Het
Spred2	G	T	11: 20,021,301	D363Y	probably damaging	Het
Tbc1d8	T	G	1: 39,372,755	Y1000S	probably benign	Het
Tdp2	A	T	13: 24,838,236	K213*	probably null	Het
Tmem89	T	C	9: 108,915,477	I146T	probably damaging	Het
Vhl	T	C	6: 113,629,463	V147A	probably benign	Het
Vmn2r23	C	T	6: 123,713,451	L429F	probably benign	Het
Vrk2	T	C	11: 26,499,036	D186G	probably damaging	Het
Wisp2	T	C	2: 163,825,359		probably null	Het
Zbtb40	A	G	4: 136,983,163	F1222L	possibly damaging	Het
Zfp266	A	G	9: 20,506,734	S7P	probably damaging	Het
Zfp472	T	A	17: 32,978,433	I494K	possibly damaging	Het
Zfp655	A	G	5: 145,244,736	E468G	probably damaging	Het

Other mutations in Son

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00531:Son	APN	16	91664322	missense	probably damaging	0.99
IGL01024:Son	APN	16	91655910	missense	probably damaging	1.00
IGL01066:Son	APN	16	91660136	intron	probably benign
IGL01083:Son	APN	16	91657391	missense	probably damaging	1.00
IGL01115:Son	APN	16	91659458	missense	probably benign	0.31
IGL01467:Son	APN	16	91657277	missense	possibly damaging	0.93
IGL01506:Son	APN	16	91657286	missense	possibly damaging	0.67
IGL01933:Son	APN	16	91658015	missense	probably benign	0.00
IGL02156:Son	APN	16	91656104	missense	possibly damaging	0.93
IGL02473:Son	APN	16	91658795	missense	probably damaging	0.99
IGL02498:Son	APN	16	91656825	missense	probably damaging	0.99
IGL02517:Son	APN	16	91655211	missense	possibly damaging	0.92
IGL02530:Son	APN	16	91658471	missense	possibly damaging	0.50
IGL02865:Son	APN	16	91651752	missense	probably damaging	1.00
IGL03180:Son	APN	16	91657008	missense	probably damaging	1.00
R0013:Son	UTSW	16	91651662	missense	probably damaging	1.00
R0036:Son	UTSW	16	91660166	intron	probably benign
R0037:Son	UTSW	16	91664728	missense	probably damaging	1.00
R0041:Son	UTSW	16	91659333	missense	probably damaging	1.00
R0048:Son	UTSW	16	91658977	missense	possibly damaging	0.94
R0048:Son	UTSW	16	91658977	missense	possibly damaging	0.94
R0056:Son	UTSW	16	91678155	missense	possibly damaging	0.86
R0227:Son	UTSW	16	91656873	missense	probably damaging	0.99
R0256:Son	UTSW	16	91656584	missense	possibly damaging	0.95
R0302:Son	UTSW	16	91656144	missense	probably damaging	1.00
R0815:Son	UTSW	16	91655484	missense	probably damaging	0.98
R1225:Son	UTSW	16	91657340	missense	probably damaging	1.00
R1255:Son	UTSW	16	91664695	missense	probably damaging	1.00
R1457:Son	UTSW	16	91657086	missense	probably damaging	1.00
R1459:Son	UTSW	16	91655342	missense	possibly damaging	0.93
R1535:Son	UTSW	16	91659734	missense	probably damaging	0.99
R1587:Son	UTSW	16	91659718	missense	probably damaging	1.00
R1605:Son	UTSW	16	91657664	missense	probably damaging	1.00
R1629:Son	UTSW	16	91657622	missense	probably damaging	1.00
R1711:Son	UTSW	16	91660226	intron	probably benign
R2138:Son	UTSW	16	91659372	missense	possibly damaging	0.95
R2245:Son	UTSW	16	91647960	splice site	probably null
R2351:Son	UTSW	16	91657659	missense	probably damaging	0.98
R2434:Son	UTSW	16	91654687	missense	probably damaging	1.00
R2870:Son	UTSW	16	91664317	splice site	probably null
R2871:Son	UTSW	16	91664317	splice site	probably null
R2872:Son	UTSW	16	91664317	splice site	probably null
R2889:Son	UTSW	16	91659899	unclassified	probably benign
R3712:Son	UTSW	16	91656726	missense	probably damaging	0.99
R3913:Son	UTSW	16	91660111	intron	probably benign
R4172:Son	UTSW	16	91659362	missense	probably damaging	1.00
R4301:Son	UTSW	16	91658411	missense	possibly damaging	0.53
R4302:Son	UTSW	16	91658411	missense	possibly damaging	0.53
R4770:Son	UTSW	16	91658868	missense	probably damaging	0.96
R4881:Son	UTSW	16	91675509	missense	probably benign	0.31
R5020:Son	UTSW	16	91656375	missense	probably damaging	1.00
R5032:Son	UTSW	16	91657664	missense	probably damaging	1.00
R5151:Son	UTSW	16	91655699	missense	probably damaging	1.00
R5153:Son	UTSW	16	91655022	missense	possibly damaging	0.86
R5215:Son	UTSW	16	91656675	missense	probably damaging	0.99
R5243:Son	UTSW	16	91654733	missense	probably damaging	1.00
R5354:Son	UTSW	16	91655739	missense	probably damaging	0.99
R5696:Son	UTSW	16	91671413	missense	possibly damaging	0.67
R5763:Son	UTSW	16	91657490	missense	probably damaging	1.00
R5766:Son	UTSW	16	91664987	intron	probably benign
R5788:Son	UTSW	16	91660052	intron	probably benign
R5992:Son	UTSW	16	91658904	missense	probably benign	0.04
R6314:Son	UTSW	16	91660410	intron	probably benign
R6371:Son	UTSW	16	91674741
R6429:Son	UTSW	16	91658166	missense	probably benign	0.33
R6451:Son	UTSW	16	91657602	missense	probably damaging	0.99
R6489:Son	UTSW	16	91655156	missense	possibly damaging	0.70
R6513:Son	UTSW	16	91659947	intron	probably benign
R6753:Son	UTSW	16	91657188	missense	probably damaging	0.99
R6916:Son	UTSW	16	91654785	missense	probably damaging	0.97
R7070:Son	UTSW	16	91656841	unclassified	probably benign
R7079:Son	UTSW	16	91656841	unclassified	probably benign
R7110:Son	UTSW	16	91656518	missense	probably benign	0.01
R7120:Son	UTSW	16	91656691	unclassified	probably benign
R7120:Son	UTSW	16	91670526	missense	unknown
R7167:Son	UTSW	16	91660334	small deletion	probably benign
R7205:Son	UTSW	16	91660295	small deletion	probably benign
R7208:Son	UTSW	16	91662102	missense	unknown
R7219:Son	UTSW	16	91665001	missense	unknown
R7249:Son	UTSW	16	91660334	small deletion	probably benign
R7328:Son	UTSW	16	91658390	missense	probably benign	0.33
R7330:Son	UTSW	16	91656598	unclassified	probably benign
R7374:Son	UTSW	16	91660334	small deletion	probably benign
R7405:Son	UTSW	16	91656691	unclassified	probably benign
R7420:Son	UTSW	16	91660334	small deletion	probably benign
R7424:Son	UTSW	16	91660334	small deletion	probably benign
R7464:Son	UTSW	16	91656691	unclassified	probably benign
R7514:Son	UTSW	16	91654860	missense	probably damaging	0.99
R7555:Son	UTSW	16	91658922	missense	probably damaging	0.99
R7645:Son	UTSW	16	91660295	small deletion	probably benign
R7716:Son	UTSW	16	91656691	unclassified	probably benign
R7718:Son	UTSW	16	91660334	small deletion	probably benign
R7778:Son	UTSW	16	91656528	missense	probably damaging	0.99
R7824:Son	UTSW	16	91656528	missense	probably damaging	0.99
R7856:Son	UTSW	16	91659258	missense	probably damaging	0.99
R7870:Son	UTSW	16	91656598	unclassified	probably benign
R7928:Son	UTSW	16	91656841	unclassified	probably benign
R7972:Son	UTSW	16	91660334	small deletion	probably benign
R7978:Son	UTSW	16	91660334	small deletion	probably benign
R8000:Son	UTSW	16	91660334	small deletion	probably benign
R8192:Son	UTSW	16	91655549	missense	possibly damaging	0.91
R8221:Son	UTSW	16	91656846	missense	probably damaging	1.00
R8227:Son	UTSW	16	91656691	unclassified	probably benign
R8233:Son	UTSW	16	91660334	small deletion	probably benign
R8255:Son	UTSW	16	91664936	missense	unknown
R8292:Son	UTSW	16	91656657	missense	possibly damaging	0.93
R8407:Son	UTSW	16	91660334	small deletion	probably benign
R8468:Son	UTSW	16	91656691	unclassified	probably benign
R8495:Son	UTSW	16	91660295	small deletion	probably benign
R8772:Son	UTSW	16	91657938	missense	possibly damaging	0.65
R8796:Son	UTSW	16	91660334	small deletion	probably benign
R8862:Son	UTSW	16	91656846	missense	probably damaging	1.00
R8962:Son	UTSW	16	91658169	missense	possibly damaging	0.91
R8972:Son	UTSW	16	91660334	small deletion	probably benign
R8991:Son	UTSW	16	91656478	missense	probably benign	0.04
R8991:Son	UTSW	16	91656720	missense	possibly damaging	0.95
R9086:Son	UTSW	16	91670530	missense	unknown
R9138:Son	UTSW	16	91655118	missense	possibly damaging	0.80
R9232:Son	UTSW	16	91656691	unclassified	probably benign
R9241:Son	UTSW	16	91657234	missense	probably damaging	0.96
R9258:Son	UTSW	16	91677682	missense	unknown
R9328:Son	UTSW	16	91655757	missense	possibly damaging	0.67
R9420:Son	UTSW	16	91657620	missense	probably damaging	0.98
R9468:Son	UTSW	16	91657551	missense	possibly damaging	0.53
R9500:Son	UTSW	16	91660334	small deletion	probably benign
R9516:Son	UTSW	16	91656691	unclassified	probably benign
R9595:Son	UTSW	16	91657353	missense	not run
RF007:Son	UTSW	16	91659369	missense	possibly damaging	0.53
RF041:Son	UTSW	16	91656691	unclassified	probably benign
Z1176:Son	UTSW	16	91655801	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- TACTGAGGTGCACCCTGAAC -3'
(R):5'- GCAATTCCTGCGACAACTG -3'

Sequencing Primer
(F):5'- GGTGCACCCTGAACCAAGC -3'
(R):5'- ACAACTGTGGCACTGGTGTC -3'

Posted On

2016-10-06