Incidental Mutation 'R5530:Tmf1'
ID433633
Institutional Source Beutler Lab
Gene Symbol Tmf1
Ensembl Gene ENSMUSG00000030059
Gene NameTATA element modulatory factor 1
Synonyms7030402D04Rik, LOC232286
MMRRC Submission 043088-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R5530 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location97152997-97179122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97158087 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 989 (S989P)
Ref Sequence ENSEMBL: ENSMUSP00000093325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095664] [ENSMUST00000124173]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083794
Predicted Effect probably damaging
Transcript: ENSMUST00000095664
AA Change: S989P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093325
Gene: ENSMUSG00000030059
AA Change: S989P

DomainStartEndE-ValueType
low complexity region 111 122 N/A INTRINSIC
low complexity region 131 142 N/A INTRINSIC
low complexity region 194 211 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 261 276 N/A INTRINSIC
low complexity region 367 381 N/A INTRINSIC
low complexity region 410 426 N/A INTRINSIC
coiled coil region 443 536 N/A INTRINSIC
Pfam:TMF_DNA_bd 540 613 5e-24 PFAM
low complexity region 697 715 N/A INTRINSIC
low complexity region 719 732 N/A INTRINSIC
low complexity region 803 821 N/A INTRINSIC
coiled coil region 823 894 N/A INTRINSIC
low complexity region 923 937 N/A INTRINSIC
Pfam:TMF_TATA_bd 972 1085 1.5e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124173
SMART Domains Protein: ENSMUSP00000120093
Gene: ENSMUSG00000030059

DomainStartEndE-ValueType
low complexity region 111 122 N/A INTRINSIC
low complexity region 131 142 N/A INTRINSIC
low complexity region 194 211 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 261 276 N/A INTRINSIC
low complexity region 367 381 N/A INTRINSIC
low complexity region 410 426 N/A INTRINSIC
coiled coil region 443 536 N/A INTRINSIC
Pfam:TMF_DNA_bd 540 613 1.4e-24 PFAM
low complexity region 697 715 N/A INTRINSIC
low complexity region 719 732 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204190
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.3%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility associated with decreased testis weight, globozoospermia, absent acrosome, asthenozoospermia, and abnormal sperm midpiece morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415F23Rik A T 1: 23,101,990 I81N probably damaging Het
Abcb6 A G 1: 75,177,912 probably benign Het
Anapc2 A G 2: 25,284,583 K653E possibly damaging Het
Aplp1 T C 7: 30,436,829 S508G possibly damaging Het
Bend3 T A 10: 43,511,726 V705D probably damaging Het
Btaf1 C A 19: 36,990,775 A1120E possibly damaging Het
Carmil3 T C 14: 55,493,624 V116A probably damaging Het
Cdk5rap3 A T 11: 96,911,633 Y238* probably null Het
Cep170 T C 1: 176,769,510 H427R probably benign Het
Cubn G A 2: 13,308,523 R3079W probably damaging Het
Edc4 G T 8: 105,889,254 E694* probably null Het
Epb41l4b A G 4: 57,086,003 S191P probably damaging Het
Fam189a2 T A 19: 23,975,594 T451S probably benign Het
Fbxo46 T C 7: 19,136,802 Y449H probably damaging Het
Ficd C A 5: 113,738,925 P387Q probably damaging Het
Grin2b T C 6: 135,733,723 T942A probably benign Het
Hoxb1 G C 11: 96,366,928 R228P probably damaging Het
Jmjd1c T C 10: 67,249,762 F2444L probably damaging Het
Kcnj2 T C 11: 111,072,091 F103S probably damaging Het
Mapkbp1 A G 2: 120,015,355 I402V probably benign Het
Mvp A G 7: 126,995,923 V250A probably benign Het
Myo1b T A 1: 51,797,423 N293I probably damaging Het
Npy5r T A 8: 66,680,860 Y427F probably benign Het
Nrd1 C T 4: 109,047,609 T747M probably damaging Het
Nrxn2 C T 19: 6,498,367 P30L possibly damaging Het
Nt5dc3 T C 10: 86,820,993 F332S probably damaging Het
Olfr116 A G 17: 37,623,807 I276T possibly damaging Het
Olfr876 A G 9: 37,804,807 T299A probably benign Het
Optc T G 1: 133,905,090 T91P probably benign Het
Otud7b A T 3: 96,141,488 E92V probably damaging Het
Pla2g4d A G 2: 120,269,555 I677T probably benign Het
Pot1a T C 6: 25,778,894 E67G probably damaging Het
Ppil6 T C 10: 41,507,498 S257P probably damaging Het
Ppp1r14a T C 7: 29,289,366 L11P probably benign Het
Pramef12 A T 4: 144,392,662 M445K probably benign Het
Rad21l A T 2: 151,657,510 I257K probably benign Het
Rbm11 A G 16: 75,592,973 D9G possibly damaging Het
Rhbdf2 T C 11: 116,600,662 Y586C probably damaging Het
Rxfp2 A T 5: 150,056,810 I276F probably damaging Het
Sec14l4 A G 11: 4,046,342 *404W probably null Het
Sec16a A G 2: 26,439,252 V917A probably benign Het
Sec61a2 A T 2: 5,882,650 Y131* probably null Het
Soga1 T A 2: 157,020,342 S1556C probably damaging Het
Sspo A T 6: 48,465,583 Y2004F probably damaging Het
Stab2 T C 10: 86,947,162 E674G probably benign Het
Tmem246 A G 4: 49,586,226 L314P probably benign Het
Tshz1 T C 18: 84,013,268 D1005G probably damaging Het
Wdr19 T C 5: 65,228,219 S555P probably benign Het
Zdhhc24 T A 19: 4,883,563 probably null Het
Zfp558 A G 9: 18,456,373 M373T probably benign Het
Other mutations in Tmf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Tmf1 APN 6 97176494 missense probably benign 0.00
IGL00846:Tmf1 APN 6 97173316 missense possibly damaging 0.88
IGL01575:Tmf1 APN 6 97175936 missense probably damaging 1.00
IGL01922:Tmf1 APN 6 97176930 missense probably benign 0.00
IGL02550:Tmf1 APN 6 97158561 missense probably benign 0.28
IGL02675:Tmf1 APN 6 97164042 splice site probably benign
IGL02985:Tmf1 APN 6 97176809 missense probably damaging 1.00
IGL03324:Tmf1 APN 6 97163653 missense probably damaging 0.99
caddy UTSW 6 97161447 nonsense probably null
R0028:Tmf1 UTSW 6 97158098 missense probably damaging 1.00
R0153:Tmf1 UTSW 6 97170384 missense probably damaging 0.97
R0325:Tmf1 UTSW 6 97176504 missense possibly damaging 0.51
R0420:Tmf1 UTSW 6 97176141 missense probably damaging 1.00
R0730:Tmf1 UTSW 6 97176492 missense probably benign
R0825:Tmf1 UTSW 6 97175995 missense probably benign
R0827:Tmf1 UTSW 6 97158050 nonsense probably null
R0839:Tmf1 UTSW 6 97176323 missense probably damaging 1.00
R1078:Tmf1 UTSW 6 97173300 missense probably damaging 1.00
R1905:Tmf1 UTSW 6 97161479 missense possibly damaging 0.53
R2274:Tmf1 UTSW 6 97163586 missense probably damaging 1.00
R3701:Tmf1 UTSW 6 97172331 missense possibly damaging 0.51
R3953:Tmf1 UTSW 6 97176206 missense probably damaging 0.99
R3955:Tmf1 UTSW 6 97176206 missense probably damaging 0.99
R4398:Tmf1 UTSW 6 97178896 missense probably damaging 0.99
R4416:Tmf1 UTSW 6 97178988 missense probably damaging 1.00
R4497:Tmf1 UTSW 6 97172332 missense probably benign 0.00
R4592:Tmf1 UTSW 6 97173400 missense probably benign 0.00
R4669:Tmf1 UTSW 6 97170427 missense probably benign 0.00
R5214:Tmf1 UTSW 6 97167292 missense possibly damaging 0.81
R5352:Tmf1 UTSW 6 97176809 missense probably damaging 1.00
R5815:Tmf1 UTSW 6 97173403 missense probably benign 0.28
R6806:Tmf1 UTSW 6 97161447 nonsense probably null
R6837:Tmf1 UTSW 6 97176581 missense possibly damaging 0.76
R6853:Tmf1 UTSW 6 97168849 missense probably damaging 0.99
R6887:Tmf1 UTSW 6 97176838 missense probably damaging 1.00
R7058:Tmf1 UTSW 6 97156950 missense probably damaging 1.00
R7145:Tmf1 UTSW 6 97176118 missense probably damaging 1.00
R7340:Tmf1 UTSW 6 97168100 missense possibly damaging 0.81
R7573:Tmf1 UTSW 6 97158494 missense probably benign 0.14
R7809:Tmf1 UTSW 6 97161459 missense probably damaging 0.99
R7833:Tmf1 UTSW 6 97161411 missense probably benign 0.06
R7916:Tmf1 UTSW 6 97161411 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGGCGACTACTTATTGGGACC -3'
(R):5'- CTCCTTTTGAGAACAGTCATAAGAC -3'

Sequencing Primer
(F):5'- CTTATTGGGACCCATTATTTCATGG -3'
(R):5'- GCAAGAATGAACAGGATCTTTGTTTG -3'
Posted On2016-10-06