Incidental Mutation 'R5530:Npy5r'
ID433639
Institutional Source Beutler Lab
Gene Symbol Npy5r
Ensembl Gene ENSMUSG00000044014
Gene Nameneuropeptide Y receptor Y5
SynonymsY5R
MMRRC Submission 043088-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R5530 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location66679965-66688128 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66680860 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 427 (Y427F)
Ref Sequence ENSEMBL: ENSMUSP00000148589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070810] [ENSMUST00000211920] [ENSMUST00000212563]
Predicted Effect probably benign
Transcript: ENSMUST00000070810
AA Change: Y427F

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000065157
Gene: ENSMUSG00000044014
AA Change: Y427F

DomainStartEndE-ValueType
internal_repeat_1 15 36 1.53e-7 PROSPERO
internal_repeat_1 36 57 1.53e-7 PROSPERO
Pfam:7TM_GPCR_Srsx 73 253 1.9e-10 PFAM
Pfam:7tm_1 79 445 2.9e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211920
AA Change: Y427F

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000212563
AA Change: Y427F

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.3%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for neuropeptide Y and peptide YY. The encoded protein appears to be involved in regulating food intake, with defects in this gene being associated with eating disorders. Also, the encoded protein is involved in a pathway that protects neuroblastoma cells from chemotherapy-induced cell death, providing a possible therapeutic target against neuroblastoma. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygotes for a null allele show increased susceptibility to diet-induced obesity and a reduced orexigenic response to select agonists. Homozygotes for a reporter allele show mild late-onset obesity, increased adiposity, polyphagia, and exacerbated obesity parameters after chronic NPY infusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415F23Rik A T 1: 23,101,990 I81N probably damaging Het
Abcb6 A G 1: 75,177,912 probably benign Het
Anapc2 A G 2: 25,284,583 K653E possibly damaging Het
Aplp1 T C 7: 30,436,829 S508G possibly damaging Het
Bend3 T A 10: 43,511,726 V705D probably damaging Het
Btaf1 C A 19: 36,990,775 A1120E possibly damaging Het
Carmil3 T C 14: 55,493,624 V116A probably damaging Het
Cdk5rap3 A T 11: 96,911,633 Y238* probably null Het
Cep170 T C 1: 176,769,510 H427R probably benign Het
Cubn G A 2: 13,308,523 R3079W probably damaging Het
Edc4 G T 8: 105,889,254 E694* probably null Het
Epb41l4b A G 4: 57,086,003 S191P probably damaging Het
Fam189a2 T A 19: 23,975,594 T451S probably benign Het
Fbxo46 T C 7: 19,136,802 Y449H probably damaging Het
Ficd C A 5: 113,738,925 P387Q probably damaging Het
Grin2b T C 6: 135,733,723 T942A probably benign Het
Hoxb1 G C 11: 96,366,928 R228P probably damaging Het
Jmjd1c T C 10: 67,249,762 F2444L probably damaging Het
Kcnj2 T C 11: 111,072,091 F103S probably damaging Het
Mapkbp1 A G 2: 120,015,355 I402V probably benign Het
Mvp A G 7: 126,995,923 V250A probably benign Het
Myo1b T A 1: 51,797,423 N293I probably damaging Het
Nrd1 C T 4: 109,047,609 T747M probably damaging Het
Nrxn2 C T 19: 6,498,367 P30L possibly damaging Het
Nt5dc3 T C 10: 86,820,993 F332S probably damaging Het
Olfr116 A G 17: 37,623,807 I276T possibly damaging Het
Olfr876 A G 9: 37,804,807 T299A probably benign Het
Optc T G 1: 133,905,090 T91P probably benign Het
Otud7b A T 3: 96,141,488 E92V probably damaging Het
Pla2g4d A G 2: 120,269,555 I677T probably benign Het
Pot1a T C 6: 25,778,894 E67G probably damaging Het
Ppil6 T C 10: 41,507,498 S257P probably damaging Het
Ppp1r14a T C 7: 29,289,366 L11P probably benign Het
Pramef12 A T 4: 144,392,662 M445K probably benign Het
Rad21l A T 2: 151,657,510 I257K probably benign Het
Rbm11 A G 16: 75,592,973 D9G possibly damaging Het
Rhbdf2 T C 11: 116,600,662 Y586C probably damaging Het
Rxfp2 A T 5: 150,056,810 I276F probably damaging Het
Sec14l4 A G 11: 4,046,342 *404W probably null Het
Sec16a A G 2: 26,439,252 V917A probably benign Het
Sec61a2 A T 2: 5,882,650 Y131* probably null Het
Soga1 T A 2: 157,020,342 S1556C probably damaging Het
Sspo A T 6: 48,465,583 Y2004F probably damaging Het
Stab2 T C 10: 86,947,162 E674G probably benign Het
Tmem246 A G 4: 49,586,226 L314P probably benign Het
Tmf1 A G 6: 97,158,087 S989P probably damaging Het
Tshz1 T C 18: 84,013,268 D1005G probably damaging Het
Wdr19 T C 5: 65,228,219 S555P probably benign Het
Zdhhc24 T A 19: 4,883,563 probably null Het
Zfp558 A G 9: 18,456,373 M373T probably benign Het
Other mutations in Npy5r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Npy5r APN 8 66681866 missense possibly damaging 0.47
IGL02192:Npy5r APN 8 66681346 missense probably benign 0.02
oleo UTSW 8 66682041 nonsense probably null
roly-poly UTSW 8 66681540 frame shift probably null
R0395:Npy5r UTSW 8 66681973 missense probably benign 0.21
R1547:Npy5r UTSW 8 66681034 missense possibly damaging 0.52
R1616:Npy5r UTSW 8 66681400 missense probably damaging 1.00
R1906:Npy5r UTSW 8 66681473 missense probably damaging 1.00
R1965:Npy5r UTSW 8 66681277 missense probably benign
R2443:Npy5r UTSW 8 66681290 nonsense probably null
R4087:Npy5r UTSW 8 66682045 missense probably damaging 0.98
R4204:Npy5r UTSW 8 66682041 nonsense probably null
R4404:Npy5r UTSW 8 66681992 missense probably benign 0.01
R5427:Npy5r UTSW 8 66681020 missense probably damaging 0.98
R5994:Npy5r UTSW 8 66682099 missense probably benign 0.06
R6041:Npy5r UTSW 8 66682023 missense possibly damaging 0.72
R6602:Npy5r UTSW 8 66681540 frame shift probably null
R6837:Npy5r UTSW 8 66681740 missense probably benign 0.00
R7879:Npy5r UTSW 8 66681316 missense possibly damaging 0.92
R7923:Npy5r UTSW 8 66681752 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCATTCAGATCCAGAACAC -3'
(R):5'- AGATGAGAGTCAAGCGTTCCC -3'

Sequencing Primer
(F):5'- CAATTAGCACAGATGTATTGTGGGC -3'
(R):5'- AGAGTCAAGCGTTCCCTCACG -3'
Posted On2016-10-06