Incidental Mutation 'R5530:Rbm11'
ID433658
Institutional Source Beutler Lab
Gene Symbol Rbm11
Ensembl Gene ENSMUSG00000032940
Gene NameRNA binding motif protein 11
Synonyms
MMRRC Submission 043088-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R5530 (G1)
Quality Score221
Status Not validated
Chromosome16
Chromosomal Location75592844-75602829 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75592973 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 9 (D9G)
Ref Sequence ENSEMBL: ENSMUSP00000109891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046378] [ENSMUST00000114249] [ENSMUST00000114253]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046378
AA Change: D9G

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038956
Gene: ENSMUSG00000032940
AA Change: D9G

DomainStartEndE-ValueType
RRM 11 83 3.25e-23 SMART
low complexity region 210 217 N/A INTRINSIC
low complexity region 228 237 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114249
AA Change: D9G

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109887
Gene: ENSMUSG00000032940
AA Change: D9G

DomainStartEndE-ValueType
RRM 11 83 3.25e-23 SMART
low complexity region 210 217 N/A INTRINSIC
low complexity region 228 237 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114253
AA Change: D9G

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109891
Gene: ENSMUSG00000032940
AA Change: D9G

DomainStartEndE-ValueType
RRM 11 83 3.25e-23 SMART
low complexity region 210 217 N/A INTRINSIC
low complexity region 228 237 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.3%
  • 20x: 91.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415F23Rik A T 1: 23,101,990 I81N probably damaging Het
Abcb6 A G 1: 75,177,912 probably benign Het
Anapc2 A G 2: 25,284,583 K653E possibly damaging Het
Aplp1 T C 7: 30,436,829 S508G possibly damaging Het
Bend3 T A 10: 43,511,726 V705D probably damaging Het
Btaf1 C A 19: 36,990,775 A1120E possibly damaging Het
Carmil3 T C 14: 55,493,624 V116A probably damaging Het
Cdk5rap3 A T 11: 96,911,633 Y238* probably null Het
Cep170 T C 1: 176,769,510 H427R probably benign Het
Cubn G A 2: 13,308,523 R3079W probably damaging Het
Edc4 G T 8: 105,889,254 E694* probably null Het
Epb41l4b A G 4: 57,086,003 S191P probably damaging Het
Fam189a2 T A 19: 23,975,594 T451S probably benign Het
Fbxo46 T C 7: 19,136,802 Y449H probably damaging Het
Ficd C A 5: 113,738,925 P387Q probably damaging Het
Grin2b T C 6: 135,733,723 T942A probably benign Het
Hoxb1 G C 11: 96,366,928 R228P probably damaging Het
Jmjd1c T C 10: 67,249,762 F2444L probably damaging Het
Kcnj2 T C 11: 111,072,091 F103S probably damaging Het
Mapkbp1 A G 2: 120,015,355 I402V probably benign Het
Mvp A G 7: 126,995,923 V250A probably benign Het
Myo1b T A 1: 51,797,423 N293I probably damaging Het
Npy5r T A 8: 66,680,860 Y427F probably benign Het
Nrd1 C T 4: 109,047,609 T747M probably damaging Het
Nrxn2 C T 19: 6,498,367 P30L possibly damaging Het
Nt5dc3 T C 10: 86,820,993 F332S probably damaging Het
Olfr116 A G 17: 37,623,807 I276T possibly damaging Het
Olfr876 A G 9: 37,804,807 T299A probably benign Het
Optc T G 1: 133,905,090 T91P probably benign Het
Otud7b A T 3: 96,141,488 E92V probably damaging Het
Pla2g4d A G 2: 120,269,555 I677T probably benign Het
Pot1a T C 6: 25,778,894 E67G probably damaging Het
Ppil6 T C 10: 41,507,498 S257P probably damaging Het
Ppp1r14a T C 7: 29,289,366 L11P probably benign Het
Pramef12 A T 4: 144,392,662 M445K probably benign Het
Rad21l A T 2: 151,657,510 I257K probably benign Het
Rhbdf2 T C 11: 116,600,662 Y586C probably damaging Het
Rxfp2 A T 5: 150,056,810 I276F probably damaging Het
Sec14l4 A G 11: 4,046,342 *404W probably null Het
Sec16a A G 2: 26,439,252 V917A probably benign Het
Sec61a2 A T 2: 5,882,650 Y131* probably null Het
Soga1 T A 2: 157,020,342 S1556C probably damaging Het
Sspo A T 6: 48,465,583 Y2004F probably damaging Het
Stab2 T C 10: 86,947,162 E674G probably benign Het
Tmem246 A G 4: 49,586,226 L314P probably benign Het
Tmf1 A G 6: 97,158,087 S989P probably damaging Het
Tshz1 T C 18: 84,013,268 D1005G probably damaging Het
Wdr19 T C 5: 65,228,219 S555P probably benign Het
Zdhhc24 T A 19: 4,883,563 probably null Het
Zfp558 A G 9: 18,456,373 M373T probably benign Het
Other mutations in Rbm11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Rbm11 APN 16 75600622 missense probably benign 0.01
IGL02245:Rbm11 APN 16 75593008 missense possibly damaging 0.74
IGL03350:Rbm11 APN 16 75600808 missense probably benign 0.31
R0060:Rbm11 UTSW 16 75598779 missense probably damaging 0.98
R0815:Rbm11 UTSW 16 75596637 missense probably damaging 1.00
R1351:Rbm11 UTSW 16 75596643 missense possibly damaging 0.91
R1562:Rbm11 UTSW 16 75596535 missense probably damaging 1.00
R1793:Rbm11 UTSW 16 75600797 missense probably damaging 1.00
R1891:Rbm11 UTSW 16 75600787 missense possibly damaging 0.87
R1965:Rbm11 UTSW 16 75598768 splice site probably null
R3757:Rbm11 UTSW 16 75596581 missense probably damaging 1.00
R3928:Rbm11 UTSW 16 75593044 critical splice donor site probably null
R4513:Rbm11 UTSW 16 75596587 missense probably damaging 1.00
R5314:Rbm11 UTSW 16 75596586 missense probably damaging 1.00
R5418:Rbm11 UTSW 16 75596535 missense probably damaging 1.00
R5891:Rbm11 UTSW 16 75598837 missense possibly damaging 0.55
R6293:Rbm11 UTSW 16 75596767 splice site probably null
R7853:Rbm11 UTSW 16 75593035 missense probably damaging 1.00
R8167:Rbm11 UTSW 16 75598785 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTTTCTAGTCAGGGAGGGC -3'
(R):5'- GAAGGGTGCTTACTATCCCG -3'

Sequencing Primer
(F):5'- GAGGTGGTGGGCGGGTC -3'
(R):5'- AGAGTACGAGCCGCTCATC -3'
Posted On2016-10-06