Incidental Mutation 'R5531:Clspn'
ID 433686
Institutional Source Beutler Lab
Gene Symbol Clspn
Ensembl Gene ENSMUSG00000042489
Gene Name claspin
Synonyms C85083, E130314M08Rik
MMRRC Submission 043089-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5531 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 126450728-126487696 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 126471566 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 907 (R907G)
Ref Sequence ENSEMBL: ENSMUSP00000045344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048391]
AlphaFold Q80YR7
Predicted Effect probably benign
Transcript: ENSMUST00000048391
AA Change: R907G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045344
Gene: ENSMUSG00000042489
AA Change: R907G

DomainStartEndE-ValueType
low complexity region 64 75 N/A INTRINSIC
coiled coil region 159 187 N/A INTRINSIC
low complexity region 214 230 N/A INTRINSIC
low complexity region 232 245 N/A INTRINSIC
low complexity region 477 490 N/A INTRINSIC
coiled coil region 599 626 N/A INTRINSIC
low complexity region 632 658 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 732 753 N/A INTRINSIC
low complexity region 793 812 N/A INTRINSIC
low complexity region 968 975 N/A INTRINSIC
coiled coil region 1001 1036 N/A INTRINSIC
low complexity region 1045 1064 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126512
SMART Domains Protein: ENSMUSP00000119437
Gene: ENSMUSG00000042489

DomainStartEndE-ValueType
coiled coil region 74 101 N/A INTRINSIC
low complexity region 108 147 N/A INTRINSIC
low complexity region 153 170 N/A INTRINSIC
low complexity region 221 242 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128202
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146944
Meta Mutation Damage Score 0.0598 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.5%
  • 10x: 95.6%
  • 20x: 92.2%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an essential upstream regulator of checkpoint kinase 1 and triggers a checkpoint arrest of the cell cycle in response to replicative stress or DNA damage. The protein is also required for efficient DNA replication during a normal S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T C 5: 114,342,767 (GRCm39) F878L possibly damaging Het
Acr T A 15: 89,458,146 (GRCm39) Y276N probably damaging Het
AI987944 A T 7: 41,023,814 (GRCm39) Y388* probably null Het
Ankrd29 G A 18: 12,412,835 (GRCm39) T114I probably damaging Het
Ap5z1 T C 5: 142,453,536 (GRCm39) M168T probably benign Het
Bard1 A C 1: 71,085,880 (GRCm39) C608W probably damaging Het
Brd10 A G 19: 29,731,072 (GRCm39) S647P possibly damaging Het
Cubn C T 2: 13,355,743 (GRCm39) V1830I probably benign Het
Cwc22 T C 2: 77,754,913 (GRCm39) N221S probably damaging Het
Dact3 A G 7: 16,609,540 (GRCm39) E64G possibly damaging Het
Dhx40 T C 11: 86,680,330 (GRCm39) E381G possibly damaging Het
Dnah7a A G 1: 53,458,907 (GRCm39) S3744P possibly damaging Het
Epha4 A G 1: 77,351,513 (GRCm39) V914A probably benign Het
Fbxw10 G A 11: 62,753,482 (GRCm39) C492Y probably damaging Het
G930045G22Rik C A 6: 50,824,756 (GRCm39) noncoding transcript Het
Gm21103 A T 14: 17,484,855 (GRCm39) I63K probably damaging Het
Gpr156 T C 16: 37,825,619 (GRCm39) V612A probably benign Het
Gucy2g A G 19: 55,229,572 (GRCm39) S33P probably benign Het
Hibch A G 1: 52,884,228 (GRCm39) probably benign Het
Hmcn1 A T 1: 150,619,539 (GRCm39) C1192S probably damaging Het
Hsd11b1 CGG CG 1: 192,922,557 (GRCm39) probably null Het
Ifi214 A G 1: 173,352,686 (GRCm39) Y248H probably damaging Het
Igf2bp2 T G 16: 21,907,835 (GRCm39) I89L probably damaging Het
Il2ra A T 2: 11,681,703 (GRCm39) T103S possibly damaging Het
Ino80 T A 2: 119,276,056 (GRCm39) M407L probably benign Het
Jade1 A C 3: 41,567,946 (GRCm39) K671N probably benign Het
Lca5 C T 9: 83,280,648 (GRCm39) S384N probably benign Het
Lce1l G T 3: 92,757,804 (GRCm39) P18H unknown Het
Lrrc8d T C 5: 105,945,536 (GRCm39) probably benign Het
Ly75 T C 2: 60,195,489 (GRCm39) N223S probably damaging Het
Mcm3 A T 1: 20,873,768 (GRCm39) F784Y possibly damaging Het
Ncf4 T G 15: 78,144,988 (GRCm39) probably benign Het
Ncoa1 T A 12: 4,303,746 (GRCm39) M1362L probably benign Het
Or1e16 T C 11: 73,286,003 (GRCm39) T282A probably benign Het
Or5p5 A G 7: 107,414,451 (GRCm39) Y220C probably benign Het
Or6c8b G C 10: 128,882,433 (GRCm39) F166L probably damaging Het
Prkg2 T C 5: 99,115,593 (GRCm39) R543G probably damaging Het
Ptprd A C 4: 75,977,904 (GRCm39) probably null Het
Scap A G 9: 110,210,497 (GRCm39) S969G possibly damaging Het
Sgk2 T C 2: 162,836,624 (GRCm39) F60S probably benign Het
Sgpp1 G T 12: 75,781,981 (GRCm39) Y119* probably null Het
Siglech A T 7: 55,418,413 (GRCm39) K31* probably null Het
Slc40a1 A G 1: 45,951,498 (GRCm39) Y220H probably damaging Het
Smurf2 G A 11: 106,743,389 (GRCm39) T219M possibly damaging Het
Speer4f2 A G 5: 17,581,526 (GRCm39) K156R possibly damaging Het
Spp1 T G 5: 104,588,424 (GRCm39) D276E probably benign Het
Stk32b T C 5: 37,617,078 (GRCm39) probably null Het
Stxbp5 G A 10: 9,638,668 (GRCm39) Q1044* probably null Het
Sv2c T A 13: 96,097,886 (GRCm39) T696S probably damaging Het
Tubgcp2 A C 7: 139,584,937 (GRCm39) probably null Het
Ubap1l C T 9: 65,278,973 (GRCm39) P91S probably damaging Het
Vmn2r76 A T 7: 85,874,657 (GRCm39) D773E probably damaging Het
Xirp2 C G 2: 67,345,646 (GRCm39) S2629C probably benign Het
Zbtb20 C A 16: 43,431,230 (GRCm39) C580* probably null Het
Zfp957 T A 14: 79,450,622 (GRCm39) Q392H unknown Het
Zfyve19 C T 2: 119,042,427 (GRCm39) T178M probably damaging Het
Zswim6 T C 13: 107,906,128 (GRCm39) noncoding transcript Het
Other mutations in Clspn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Clspn APN 4 126,466,971 (GRCm39) missense probably damaging 1.00
IGL02160:Clspn APN 4 126,475,303 (GRCm39) missense probably benign 0.21
IGL02231:Clspn APN 4 126,453,021 (GRCm39) missense probably damaging 0.98
IGL02281:Clspn APN 4 126,459,563 (GRCm39) missense possibly damaging 0.90
IGL02368:Clspn APN 4 126,459,900 (GRCm39) missense probably benign
IGL03149:Clspn APN 4 126,470,295 (GRCm39) splice site probably benign
Durch UTSW 4 126,474,755 (GRCm39) missense probably damaging 0.99
R0012:Clspn UTSW 4 126,458,722 (GRCm39) unclassified probably benign
R0035:Clspn UTSW 4 126,458,796 (GRCm39) splice site probably null
R0035:Clspn UTSW 4 126,458,796 (GRCm39) splice site probably null
R0207:Clspn UTSW 4 126,484,391 (GRCm39) missense possibly damaging 0.82
R0270:Clspn UTSW 4 126,467,029 (GRCm39) missense probably damaging 1.00
R0825:Clspn UTSW 4 126,466,923 (GRCm39) splice site probably benign
R1082:Clspn UTSW 4 126,471,572 (GRCm39) missense possibly damaging 0.95
R1349:Clspn UTSW 4 126,457,770 (GRCm39) missense probably benign
R1568:Clspn UTSW 4 126,475,310 (GRCm39) missense probably benign 0.01
R1649:Clspn UTSW 4 126,460,228 (GRCm39) unclassified probably benign
R1663:Clspn UTSW 4 126,459,768 (GRCm39) missense probably benign 0.00
R2497:Clspn UTSW 4 126,466,140 (GRCm39) missense possibly damaging 0.79
R3107:Clspn UTSW 4 126,485,452 (GRCm39) missense probably benign 0.06
R3951:Clspn UTSW 4 126,470,172 (GRCm39) missense probably damaging 1.00
R3953:Clspn UTSW 4 126,460,230 (GRCm39) frame shift probably null
R3954:Clspn UTSW 4 126,460,230 (GRCm39) frame shift probably null
R3956:Clspn UTSW 4 126,460,230 (GRCm39) frame shift probably null
R4599:Clspn UTSW 4 126,475,253 (GRCm39) missense probably benign 0.14
R4717:Clspn UTSW 4 126,453,849 (GRCm39) missense probably damaging 1.00
R4853:Clspn UTSW 4 126,460,348 (GRCm39) missense probably damaging 0.99
R4854:Clspn UTSW 4 126,469,743 (GRCm39) missense probably benign
R4979:Clspn UTSW 4 126,472,179 (GRCm39) missense probably damaging 1.00
R5363:Clspn UTSW 4 126,455,579 (GRCm39) missense possibly damaging 0.58
R5614:Clspn UTSW 4 126,474,755 (GRCm39) missense probably damaging 0.99
R5706:Clspn UTSW 4 126,472,211 (GRCm39) missense probably damaging 1.00
R5806:Clspn UTSW 4 126,479,899 (GRCm39) missense probably damaging 1.00
R6106:Clspn UTSW 4 126,484,434 (GRCm39) missense probably benign 0.00
R6178:Clspn UTSW 4 126,471,529 (GRCm39) splice site probably null
R6223:Clspn UTSW 4 126,479,961 (GRCm39) missense probably damaging 0.99
R6326:Clspn UTSW 4 126,459,532 (GRCm39) missense probably damaging 1.00
R6398:Clspn UTSW 4 126,457,740 (GRCm39) missense probably damaging 1.00
R6714:Clspn UTSW 4 126,459,561 (GRCm39) missense probably damaging 1.00
R7003:Clspn UTSW 4 126,486,513 (GRCm39) missense possibly damaging 0.63
R7034:Clspn UTSW 4 126,474,775 (GRCm39) missense possibly damaging 0.87
R7358:Clspn UTSW 4 126,459,993 (GRCm39) missense probably benign 0.02
R7376:Clspn UTSW 4 126,484,430 (GRCm39) missense possibly damaging 0.65
R7675:Clspn UTSW 4 126,460,113 (GRCm39) missense probably benign 0.00
R8320:Clspn UTSW 4 126,457,743 (GRCm39) missense possibly damaging 0.73
R8517:Clspn UTSW 4 126,460,012 (GRCm39) missense probably benign 0.00
R8547:Clspn UTSW 4 126,455,609 (GRCm39) missense probably damaging 1.00
R9106:Clspn UTSW 4 126,471,243 (GRCm39) intron probably benign
R9223:Clspn UTSW 4 126,484,411 (GRCm39) missense possibly damaging 0.60
R9361:Clspn UTSW 4 126,479,654 (GRCm39) missense probably damaging 0.99
R9527:Clspn UTSW 4 126,453,792 (GRCm39) nonsense probably null
R9717:Clspn UTSW 4 126,458,756 (GRCm39) missense possibly damaging 0.90
T0975:Clspn UTSW 4 126,460,230 (GRCm39) unclassified probably benign
X0014:Clspn UTSW 4 126,469,736 (GRCm39) missense probably damaging 1.00
Z1177:Clspn UTSW 4 126,459,970 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGGTAATTTCCGACACTTCAC -3'
(R):5'- TGAGGAAGTGGCAGGATTCC -3'

Sequencing Primer
(F):5'- GGGTAATTTCCGACACTTCACTGTAC -3'
(R):5'- ATCCCTGTTTTCTGTGCACTTAC -3'
Posted On 2016-10-06