Mutagenetix > Incidental Mutation

Incidental Mutation 'R5531:Clspn'

433686

Institutional Source

Beutler Lab

Gene Symbol

Clspn

Ensembl Gene

ENSMUSG00000042489

Gene Name

claspin

Synonyms

C85083, E130314M08Rik

MMRRC Submission

043089-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5531 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

126556935-126593903 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 126577773 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 907 (R907G)

Ref Sequence

ENSEMBL: ENSMUSP00000045344 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048391]

AlphaFold

Q80YR7

Predicted Effect

probably benign
Transcript: ENSMUST00000048391
AA Change: R907G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000045344
Gene: ENSMUSG00000042489
AA Change: R907G

Domain	Start	End	E-Value	Type
low complexity region	64	75	N/A	INTRINSIC
coiled coil region	159	187	N/A	INTRINSIC
low complexity region	214	230	N/A	INTRINSIC
low complexity region	232	245	N/A	INTRINSIC
low complexity region	477	490	N/A	INTRINSIC
coiled coil region	599	626	N/A	INTRINSIC
low complexity region	632	658	N/A	INTRINSIC
low complexity region	664	681	N/A	INTRINSIC
low complexity region	732	753	N/A	INTRINSIC
low complexity region	793	812	N/A	INTRINSIC
low complexity region	968	975	N/A	INTRINSIC
coiled coil region	1001	1036	N/A	INTRINSIC
low complexity region	1045	1064	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000126512

SMART Domains

Protein: ENSMUSP00000119437
Gene: ENSMUSG00000042489

Domain	Start	End	E-Value	Type
coiled coil region	74	101	N/A	INTRINSIC
low complexity region	108	147	N/A	INTRINSIC
low complexity region	153	170	N/A	INTRINSIC
low complexity region	221	242	N/A	INTRINSIC
low complexity region	282	301	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128202

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146944

Meta Mutation Damage Score

0.0598

Coding Region Coverage

1x: 98.6%
3x: 97.5%
10x: 95.6%
20x: 92.2%

Validation Efficiency

97% (64/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an essential upstream regulator of checkpoint kinase 1 and triggers a checkpoint arrest of the cell cycle in response to replicative stress or DNA damage. The protein is also required for efficient DNA replication during a normal S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930021J03Rik	A	G	19: 29,753,672	S647P	possibly damaging	Het
Acacb	T	C	5: 114,204,706	F878L	possibly damaging	Het
Acr	T	A	15: 89,573,943	Y276N	probably damaging	Het
AI987944	A	T	7: 41,374,390	Y388*	probably null	Het
Ankrd29	G	A	18: 12,279,778	T114I	probably damaging	Het
Ap5z1	T	C	5: 142,467,781	M168T	probably benign	Het
Bard1	A	C	1: 71,046,721	C608W	probably damaging	Het
Cubn	C	T	2: 13,350,932	V1830I	probably benign	Het
Cwc22	T	C	2: 77,924,569	N221S	probably damaging	Het
Dact3	A	G	7: 16,875,615	E64G	possibly damaging	Het
Dhx40	T	C	11: 86,789,504	E381G	possibly damaging	Het
Dnah7a	A	G	1: 53,419,748	S3744P	possibly damaging	Het
Epha4	A	G	1: 77,374,876	V914A	probably benign	Het
Fbxw10	G	A	11: 62,862,656	C492Y	probably damaging	Het
G930045G22Rik	C	A	6: 50,847,776		noncoding transcript	Het
Gm21103	A	T	14: 6,303,861	I63K	probably damaging	Het
Gpr156	T	C	16: 38,005,257	V612A	probably benign	Het
Gucy2g	A	G	19: 55,241,140	S33P	probably benign	Het
Hibch	A	G	1: 52,845,069		probably benign	Het
Hmcn1	A	T	1: 150,743,788	C1192S	probably damaging	Het
Hsd11b1	CGG	CG	1: 193,240,249		probably null	Het
Ifi214	A	G	1: 173,525,120	Y248H	probably damaging	Het
Igf2bp2	T	G	16: 22,089,085	I89L	probably damaging	Het
Il2ra	A	T	2: 11,676,892	T103S	possibly damaging	Het
Ino80	T	A	2: 119,445,575	M407L	probably benign	Het
Jade1	A	C	3: 41,613,511	K671N	probably benign	Het
Lca5	C	T	9: 83,398,595	S384N	probably benign	Het
Lce1l	G	T	3: 92,850,497	P18H	unknown	Het
Lrrc8d	T	C	5: 105,797,670		probably benign	Het
Ly75	T	C	2: 60,365,145	N223S	probably damaging	Het
Mcm3	A	T	1: 20,803,544	F784Y	possibly damaging	Het
Ncf4	T	G	15: 78,260,788		probably benign	Het
Ncoa1	T	A	12: 4,253,746	M1362L	probably benign	Het
Olfr1	T	C	11: 73,395,177	T282A	probably benign	Het
Olfr467	A	G	7: 107,815,244	Y220C	probably benign	Het
Olfr765	G	C	10: 129,046,564	F166L	probably damaging	Het
Prkg2	T	C	5: 98,967,734	R543G	probably damaging	Het
Ptprd	A	C	4: 76,059,667		probably null	Het
Scap	A	G	9: 110,381,429	S969G	possibly damaging	Het
Sgk2	T	C	2: 162,994,704	F60S	probably benign	Het
Sgpp1	G	T	12: 75,735,207	Y119*	probably null	Het
Siglech	A	T	7: 55,768,665	K31*	probably null	Het
Slc40a1	A	G	1: 45,912,338	Y220H	probably damaging	Het
Smurf2	G	A	11: 106,852,563	T219M	possibly damaging	Het
Speer4f2	A	G	5: 17,376,528	K156R	possibly damaging	Het
Spp1	T	G	5: 104,440,558	D276E	probably benign	Het
Stk32b	T	C	5: 37,459,734		probably null	Het
Stxbp5	G	A	10: 9,762,924	Q1044*	probably null	Het
Sv2c	T	A	13: 95,961,378	T696S	probably damaging	Het
Tubgcp2	A	C	7: 140,005,024		probably null	Het
Ubap1l	C	T	9: 65,371,691	P91S	probably damaging	Het
Vmn2r76	A	T	7: 86,225,449	D773E	probably damaging	Het
Xirp2	C	G	2: 67,515,302	S2629C	probably benign	Het
Zbtb20	C	A	16: 43,610,867	C580*	probably null	Het
Zfp957	T	A	14: 79,213,182	Q392H	unknown	Het
Zfyve19	C	T	2: 119,211,946	T178M	probably damaging	Het
Zswim6	T	C	13: 107,769,593		noncoding transcript	Het

Other mutations in Clspn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01149:Clspn	APN	4	126573178	missense	probably damaging	1.00
IGL02160:Clspn	APN	4	126581510	missense	probably benign	0.21
IGL02231:Clspn	APN	4	126559228	missense	probably damaging	0.98
IGL02281:Clspn	APN	4	126565770	missense	possibly damaging	0.90
IGL02368:Clspn	APN	4	126566107	missense	probably benign
IGL03149:Clspn	APN	4	126576502	splice site	probably benign
Durch	UTSW	4	126580962	missense	probably damaging	0.99
R0012:Clspn	UTSW	4	126564929	unclassified	probably benign
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0207:Clspn	UTSW	4	126590598	missense	possibly damaging	0.82
R0270:Clspn	UTSW	4	126573236	missense	probably damaging	1.00
R0825:Clspn	UTSW	4	126573130	splice site	probably benign
R1082:Clspn	UTSW	4	126577779	missense	possibly damaging	0.95
R1349:Clspn	UTSW	4	126563977	missense	probably benign
R1568:Clspn	UTSW	4	126581517	missense	probably benign	0.01
R1649:Clspn	UTSW	4	126566435	unclassified	probably benign
R1663:Clspn	UTSW	4	126565975	missense	probably benign	0.00
R2497:Clspn	UTSW	4	126572347	missense	possibly damaging	0.79
R3107:Clspn	UTSW	4	126591659	missense	probably benign	0.06
R3951:Clspn	UTSW	4	126576379	missense	probably damaging	1.00
R3953:Clspn	UTSW	4	126566437	frame shift	probably null
R3954:Clspn	UTSW	4	126566437	frame shift	probably null
R3956:Clspn	UTSW	4	126566437	frame shift	probably null
R4599:Clspn	UTSW	4	126581460	missense	probably benign	0.14
R4717:Clspn	UTSW	4	126560056	missense	probably damaging	1.00
R4853:Clspn	UTSW	4	126566555	missense	probably damaging	0.99
R4854:Clspn	UTSW	4	126575950	missense	probably benign
R4979:Clspn	UTSW	4	126578386	missense	probably damaging	1.00
R5363:Clspn	UTSW	4	126561786	missense	possibly damaging	0.58
R5614:Clspn	UTSW	4	126580962	missense	probably damaging	0.99
R5706:Clspn	UTSW	4	126578418	missense	probably damaging	1.00
R5806:Clspn	UTSW	4	126586106	missense	probably damaging	1.00
R6106:Clspn	UTSW	4	126590641	missense	probably benign	0.00
R6178:Clspn	UTSW	4	126577736	splice site	probably null
R6223:Clspn	UTSW	4	126586168	missense	probably damaging	0.99
R6326:Clspn	UTSW	4	126565739	missense	probably damaging	1.00
R6398:Clspn	UTSW	4	126563947	missense	probably damaging	1.00
R6714:Clspn	UTSW	4	126565768	missense	probably damaging	1.00
R7003:Clspn	UTSW	4	126592720	missense	possibly damaging	0.63
R7034:Clspn	UTSW	4	126580982	missense	possibly damaging	0.87
R7358:Clspn	UTSW	4	126566200	missense	probably benign	0.02
R7376:Clspn	UTSW	4	126590637	missense	possibly damaging	0.65
R7675:Clspn	UTSW	4	126566320	missense	probably benign	0.00
R8320:Clspn	UTSW	4	126563950	missense	possibly damaging	0.73
R8517:Clspn	UTSW	4	126566219	missense	probably benign	0.00
R8547:Clspn	UTSW	4	126561816	missense	probably damaging	1.00
R9106:Clspn	UTSW	4	126577450	intron	probably benign
R9223:Clspn	UTSW	4	126590618	missense	possibly damaging	0.60
R9361:Clspn	UTSW	4	126585861	missense	probably damaging	0.99
R9527:Clspn	UTSW	4	126559999	nonsense	probably null
R9717:Clspn	UTSW	4	126564963	missense	possibly damaging	0.90
T0975:Clspn	UTSW	4	126566437	unclassified	probably benign
X0014:Clspn	UTSW	4	126575943	missense	probably damaging	1.00
Z1177:Clspn	UTSW	4	126566177	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGGGTAATTTCCGACACTTCAC -3'
(R):5'- TGAGGAAGTGGCAGGATTCC -3'

Sequencing Primer
(F):5'- GGGTAATTTCCGACACTTCACTGTAC -3'
(R):5'- ATCCCTGTTTTCTGTGCACTTAC -3'

Posted On

2016-10-06