Mutagenetix > Incidental Mutation

Incidental Mutation 'R5531:Vmn2r76'

433697

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r76

Ensembl Gene

ENSMUSG00000091239

Gene Name

vomeronasal 2, receptor 76

Synonyms

MMRRC Submission

043089-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.128) question?

Stock #

R5531 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86225206-86246201 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 86225449 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 773 (D773E)

Ref Sequence

ENSEMBL: ENSMUSP00000127309 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165771]

AlphaFold

E9Q3F5

Predicted Effect

probably damaging
Transcript: ENSMUST00000165771
AA Change: D773E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000127309
Gene: ENSMUSG00000091239
AA Change: D773E

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	78	470	1.2e-29	PFAM
low complexity region	476	489	N/A	INTRINSIC
Pfam:NCD3G	513	565	3.7e-22	PFAM
Pfam:7tm_3	598	833	1.4e-52	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 98.6%
3x: 97.5%
10x: 95.6%
20x: 92.2%

Validation Efficiency

97% (64/66)

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930021J03Rik	A	G	19: 29,753,672	S647P	possibly damaging	Het
Acacb	T	C	5: 114,204,706	F878L	possibly damaging	Het
Acr	T	A	15: 89,573,943	Y276N	probably damaging	Het
AI987944	A	T	7: 41,374,390	Y388*	probably null	Het
Ankrd29	G	A	18: 12,279,778	T114I	probably damaging	Het
Ap5z1	T	C	5: 142,467,781	M168T	probably benign	Het
Bard1	A	C	1: 71,046,721	C608W	probably damaging	Het
Clspn	A	G	4: 126,577,773	R907G	probably benign	Het
Cubn	C	T	2: 13,350,932	V1830I	probably benign	Het
Cwc22	T	C	2: 77,924,569	N221S	probably damaging	Het
Dact3	A	G	7: 16,875,615	E64G	possibly damaging	Het
Dhx40	T	C	11: 86,789,504	E381G	possibly damaging	Het
Dnah7a	A	G	1: 53,419,748	S3744P	possibly damaging	Het
Epha4	A	G	1: 77,374,876	V914A	probably benign	Het
Fbxw10	G	A	11: 62,862,656	C492Y	probably damaging	Het
G930045G22Rik	C	A	6: 50,847,776		noncoding transcript	Het
Gm21103	A	T	14: 6,303,861	I63K	probably damaging	Het
Gpr156	T	C	16: 38,005,257	V612A	probably benign	Het
Gucy2g	A	G	19: 55,241,140	S33P	probably benign	Het
Hibch	A	G	1: 52,845,069		probably benign	Het
Hmcn1	A	T	1: 150,743,788	C1192S	probably damaging	Het
Hsd11b1	CGG	CG	1: 193,240,249		probably null	Het
Ifi214	A	G	1: 173,525,120	Y248H	probably damaging	Het
Igf2bp2	T	G	16: 22,089,085	I89L	probably damaging	Het
Il2ra	A	T	2: 11,676,892	T103S	possibly damaging	Het
Ino80	T	A	2: 119,445,575	M407L	probably benign	Het
Jade1	A	C	3: 41,613,511	K671N	probably benign	Het
Lca5	C	T	9: 83,398,595	S384N	probably benign	Het
Lce1l	G	T	3: 92,850,497	P18H	unknown	Het
Lrrc8d	T	C	5: 105,797,670		probably benign	Het
Ly75	T	C	2: 60,365,145	N223S	probably damaging	Het
Mcm3	A	T	1: 20,803,544	F784Y	possibly damaging	Het
Ncf4	T	G	15: 78,260,788		probably benign	Het
Ncoa1	T	A	12: 4,253,746	M1362L	probably benign	Het
Olfr1	T	C	11: 73,395,177	T282A	probably benign	Het
Olfr467	A	G	7: 107,815,244	Y220C	probably benign	Het
Olfr765	G	C	10: 129,046,564	F166L	probably damaging	Het
Prkg2	T	C	5: 98,967,734	R543G	probably damaging	Het
Ptprd	A	C	4: 76,059,667		probably null	Het
Scap	A	G	9: 110,381,429	S969G	possibly damaging	Het
Sgk2	T	C	2: 162,994,704	F60S	probably benign	Het
Sgpp1	G	T	12: 75,735,207	Y119*	probably null	Het
Siglech	A	T	7: 55,768,665	K31*	probably null	Het
Slc40a1	A	G	1: 45,912,338	Y220H	probably damaging	Het
Smurf2	G	A	11: 106,852,563	T219M	possibly damaging	Het
Speer4f2	A	G	5: 17,376,528	K156R	possibly damaging	Het
Spp1	T	G	5: 104,440,558	D276E	probably benign	Het
Stk32b	T	C	5: 37,459,734		probably null	Het
Stxbp5	G	A	10: 9,762,924	Q1044*	probably null	Het
Sv2c	T	A	13: 95,961,378	T696S	probably damaging	Het
Tubgcp2	A	C	7: 140,005,024		probably null	Het
Ubap1l	C	T	9: 65,371,691	P91S	probably damaging	Het
Xirp2	C	G	2: 67,515,302	S2629C	probably benign	Het
Zbtb20	C	A	16: 43,610,867	C580*	probably null	Het
Zfp957	T	A	14: 79,213,182	Q392H	unknown	Het
Zfyve19	C	T	2: 119,211,946	T178M	probably damaging	Het
Zswim6	T	C	13: 107,769,593		noncoding transcript	Het

Other mutations in Vmn2r76

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00969:Vmn2r76	APN	7	86228717	missense	probably benign
IGL01374:Vmn2r76	APN	7	86225649	missense	probably benign	0.02
IGL01419:Vmn2r76	APN	7	86225702	missense	probably benign	0.32
IGL01627:Vmn2r76	APN	7	86225663	missense	probably damaging	1.00
IGL01730:Vmn2r76	APN	7	86230198	missense	probably benign	0.02
IGL01957:Vmn2r76	APN	7	86228717	missense	probably benign
IGL02214:Vmn2r76	APN	7	86229930	missense	probably benign	0.07
IGL02489:Vmn2r76	APN	7	86228863	missense	probably benign	0.41
IGL02543:Vmn2r76	APN	7	86230148	missense	probably benign	0.06
IGL02579:Vmn2r76	APN	7	86228753	nonsense	probably null
IGL02598:Vmn2r76	APN	7	86228671	missense	probably benign	0.05
IGL02720:Vmn2r76	APN	7	86225706	missense	probably benign	0.35
IGL02745:Vmn2r76	APN	7	86230287	missense	probably benign	0.06
IGL03393:Vmn2r76	APN	7	86229826	missense	probably benign	0.01
R0483:Vmn2r76	UTSW	7	86225751	missense	probably damaging	1.00
R0513:Vmn2r76	UTSW	7	86228779	missense	probably benign	0.01
R0528:Vmn2r76	UTSW	7	86230298	missense	possibly damaging	0.80
R0601:Vmn2r76	UTSW	7	86226115	critical splice acceptor site	probably null
R0662:Vmn2r76	UTSW	7	86230370	missense	probably benign	0.39
R0883:Vmn2r76	UTSW	7	86228696	missense	probably benign	0.00
R1532:Vmn2r76	UTSW	7	86230246	missense	probably benign	0.02
R1694:Vmn2r76	UTSW	7	86230148	missense	probably benign	0.06
R1696:Vmn2r76	UTSW	7	86231256	missense	possibly damaging	0.56
R2135:Vmn2r76	UTSW	7	86231011	missense	probably benign	0.02
R2151:Vmn2r76	UTSW	7	86230484	missense	probably benign
R2181:Vmn2r76	UTSW	7	86225535	missense	probably benign	0.00
R2268:Vmn2r76	UTSW	7	86230499	missense	probably benign	0.03
R2877:Vmn2r76	UTSW	7	86225993	missense	probably benign	0.00
R3155:Vmn2r76	UTSW	7	86225751	missense	probably damaging	1.00
R3746:Vmn2r76	UTSW	7	86225555	missense	probably benign	0.11
R3799:Vmn2r76	UTSW	7	86226036	missense	probably benign	0.00
R3825:Vmn2r76	UTSW	7	86231207	missense	probably benign	0.10
R4058:Vmn2r76	UTSW	7	86230300	missense	probably benign	0.00
R4237:Vmn2r76	UTSW	7	86230532	missense	probably benign	0.00
R4404:Vmn2r76	UTSW	7	86228303	missense	probably benign	0.16
R4796:Vmn2r76	UTSW	7	86230444	missense	possibly damaging	0.95
R4838:Vmn2r76	UTSW	7	86225525	missense	probably damaging	1.00
R5175:Vmn2r76	UTSW	7	86228707	missense	probably benign	0.00
R5268:Vmn2r76	UTSW	7	86226059	missense	probably damaging	1.00
R5381:Vmn2r76	UTSW	7	86225288	missense	probably damaging	1.00
R5566:Vmn2r76	UTSW	7	86226078	missense	probably damaging	1.00
R5646:Vmn2r76	UTSW	7	86226053	missense	probably damaging	0.98
R5664:Vmn2r76	UTSW	7	86245994	critical splice donor site	probably null
R5818:Vmn2r76	UTSW	7	86229934	missense	probably benign	0.00
R6093:Vmn2r76	UTSW	7	86228261	nonsense	probably null
R6651:Vmn2r76	UTSW	7	86228851	missense	possibly damaging	0.64
R6741:Vmn2r76	UTSW	7	86230352	missense	probably benign
R6750:Vmn2r76	UTSW	7	86225906	missense	probably damaging	1.00
R7082:Vmn2r76	UTSW	7	86225232	missense	probably benign	0.01
R7136:Vmn2r76	UTSW	7	86228767	missense	probably benign	0.06
R7524:Vmn2r76	UTSW	7	86225369	missense	probably benign	0.22
R7524:Vmn2r76	UTSW	7	86230166	missense	probably benign	0.00
R7611:Vmn2r76	UTSW	7	86230180	missense	probably benign	0.04
R7833:Vmn2r76	UTSW	7	86228684	missense	probably benign
R8002:Vmn2r76	UTSW	7	86230063	missense	probably benign	0.05
R8021:Vmn2r76	UTSW	7	86225750	missense	probably damaging	1.00
R8023:Vmn2r76	UTSW	7	86229820	missense	probably benign	0.00
R8250:Vmn2r76	UTSW	7	86226023	missense	possibly damaging	0.82
R8428:Vmn2r76	UTSW	7	86225271	missense	possibly damaging	0.63
R8874:Vmn2r76	UTSW	7	86228791	missense	probably damaging	1.00
R9139:Vmn2r76	UTSW	7	86229962	missense	probably benign	0.02
R9357:Vmn2r76	UTSW	7	86231220	missense	probably benign	0.43
Z1176:Vmn2r76	UTSW	7	86246063	missense	probably benign	0.39

Predicted Primers

PCR Primer
(F):5'- TTATCATTAGAAGCAGGAATGTGGG -3'
(R):5'- AATCTGGCTGGGAACTTCTCC -3'

Sequencing Primer
(F):5'- AGCATTTTTGTGCCTAAACTTGTG -3'
(R):5'- GGAACTTCTCCACCATTTGTTGATAG -3'

Posted On

2016-10-06