Incidental Mutation 'R5531:Olfr467'
ID433699
Institutional Source Beutler Lab
Gene Symbol Olfr467
Ensembl Gene ENSMUSG00000066242
Gene Nameolfactory receptor 467
SynonymsMOR204-33P, GA_x6K02T2PBJ9-10144091-10145011
MMRRC Submission 043089-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R5531 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location107812263-107816336 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107815244 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 220 (Y220C)
Ref Sequence ENSEMBL: ENSMUSP00000149295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084756] [ENSMUST00000208563] [ENSMUST00000214253]
Predicted Effect probably benign
Transcript: ENSMUST00000084756
AA Change: Y222C

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000081811
Gene: ENSMUSG00000066242
AA Change: Y222C

DomainStartEndE-ValueType
Pfam:7tm_4 33 308 5.3e-52 PFAM
Pfam:7TM_GPCR_Srsx 37 307 8.3e-7 PFAM
Pfam:7tm_1 43 292 2.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207203
Predicted Effect probably benign
Transcript: ENSMUST00000208563
AA Change: Y220C

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000214253
AA Change: Y220C

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.5%
  • 10x: 95.6%
  • 20x: 92.2%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,753,672 S647P possibly damaging Het
Acacb T C 5: 114,204,706 F878L possibly damaging Het
Acr T A 15: 89,573,943 Y276N probably damaging Het
AI987944 A T 7: 41,374,390 Y388* probably null Het
Ankrd29 G A 18: 12,279,778 T114I probably damaging Het
Ap5z1 T C 5: 142,467,781 M168T probably benign Het
Bard1 A C 1: 71,046,721 C608W probably damaging Het
Clspn A G 4: 126,577,773 R907G probably benign Het
Cubn C T 2: 13,350,932 V1830I probably benign Het
Cwc22 T C 2: 77,924,569 N221S probably damaging Het
Dact3 A G 7: 16,875,615 E64G possibly damaging Het
Dhx40 T C 11: 86,789,504 E381G possibly damaging Het
Dnah7a A G 1: 53,419,748 S3744P possibly damaging Het
Epha4 A G 1: 77,374,876 V914A probably benign Het
Fbxw10 G A 11: 62,862,656 C492Y probably damaging Het
G930045G22Rik C A 6: 50,847,776 noncoding transcript Het
Gm21103 A T 14: 6,303,861 I63K probably damaging Het
Gpr156 T C 16: 38,005,257 V612A probably benign Het
Gucy2g A G 19: 55,241,140 S33P probably benign Het
Hibch A G 1: 52,845,069 probably benign Het
Hmcn1 A T 1: 150,743,788 C1192S probably damaging Het
Hsd11b1 CGG CG 1: 193,240,249 probably null Het
Ifi214 A G 1: 173,525,120 Y248H probably damaging Het
Igf2bp2 T G 16: 22,089,085 I89L probably damaging Het
Il2ra A T 2: 11,676,892 T103S possibly damaging Het
Ino80 T A 2: 119,445,575 M407L probably benign Het
Jade1 A C 3: 41,613,511 K671N probably benign Het
Lca5 C T 9: 83,398,595 S384N probably benign Het
Lce1l G T 3: 92,850,497 P18H unknown Het
Lrrc8d T C 5: 105,797,670 probably benign Het
Ly75 T C 2: 60,365,145 N223S probably damaging Het
Mcm3 A T 1: 20,803,544 F784Y possibly damaging Het
Ncf4 T G 15: 78,260,788 probably benign Het
Ncoa1 T A 12: 4,253,746 M1362L probably benign Het
Olfr1 T C 11: 73,395,177 T282A probably benign Het
Olfr765 G C 10: 129,046,564 F166L probably damaging Het
Prkg2 T C 5: 98,967,734 R543G probably damaging Het
Ptprd A C 4: 76,059,667 probably null Het
Scap A G 9: 110,381,429 S969G possibly damaging Het
Sgk2 T C 2: 162,994,704 F60S probably benign Het
Sgpp1 G T 12: 75,735,207 Y119* probably null Het
Siglech A T 7: 55,768,665 K31* probably null Het
Slc40a1 A G 1: 45,912,338 Y220H probably damaging Het
Smurf2 G A 11: 106,852,563 T219M possibly damaging Het
Speer4f2 A G 5: 17,376,528 K156R possibly damaging Het
Spp1 T G 5: 104,440,558 D276E probably benign Het
Stk32b T C 5: 37,459,734 probably null Het
Stxbp5 G A 10: 9,762,924 Q1044* probably null Het
Sv2c T A 13: 95,961,378 T696S probably damaging Het
Tubgcp2 A C 7: 140,005,024 probably null Het
Ubap1l C T 9: 65,371,691 P91S probably damaging Het
Vmn2r76 A T 7: 86,225,449 D773E probably damaging Het
Xirp2 C G 2: 67,515,302 S2629C probably benign Het
Zbtb20 C A 16: 43,610,867 C580* probably null Het
Zfp957 T A 14: 79,213,182 Q392H unknown Het
Zfyve19 C T 2: 119,211,946 T178M probably damaging Het
Zswim6 T C 13: 107,769,593 noncoding transcript Het
Other mutations in Olfr467
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0110:Olfr467 UTSW 7 107814688 missense probably damaging 1.00
R0450:Olfr467 UTSW 7 107814688 missense probably damaging 1.00
R0707:Olfr467 UTSW 7 107815124 missense probably damaging 0.99
R0918:Olfr467 UTSW 7 107815211 missense probably benign 0.03
R1416:Olfr467 UTSW 7 107815262 missense probably damaging 1.00
R1988:Olfr467 UTSW 7 107814700 missense probably benign
R1989:Olfr467 UTSW 7 107814700 missense probably benign
R2219:Olfr467 UTSW 7 107815222 missense probably benign
R2241:Olfr467 UTSW 7 107814833 missense possibly damaging 0.62
R2866:Olfr467 UTSW 7 107814919 missense probably benign 0.06
R4946:Olfr467 UTSW 7 107815382 missense possibly damaging 0.90
R4972:Olfr467 UTSW 7 107814746 missense probably benign 0.10
R5099:Olfr467 UTSW 7 107814602 missense probably benign 0.00
R5310:Olfr467 UTSW 7 107814964 missense probably damaging 1.00
R5323:Olfr467 UTSW 7 107814676 missense possibly damaging 0.96
R5672:Olfr467 UTSW 7 107814637 missense probably damaging 1.00
R5758:Olfr467 UTSW 7 107814815 missense probably damaging 0.99
R5891:Olfr467 UTSW 7 107815180 missense probably damaging 1.00
R6016:Olfr467 UTSW 7 107815012 missense probably benign 0.01
R6399:Olfr467 UTSW 7 107814754 missense possibly damaging 0.78
R6466:Olfr467 UTSW 7 107814694 missense probably benign
R6894:Olfr467 UTSW 7 107815064 missense probably benign 0.25
R7543:Olfr467 UTSW 7 107815101 missense probably damaging 1.00
R8316:Olfr467 UTSW 7 107814823 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AGGTCTGCCTCATCTTATTGG -3'
(R):5'- TTCAGCATGGGGATCACCAC -3'

Sequencing Primer
(F):5'- GTGTAAATTCTTCATCATTCACCAGC -3'
(R):5'- CATGGGGATCACCACTGTGTAG -3'
Posted On2016-10-06